Description :
From Genome Similarity Track
Location :
Scaffold_9:139472- 141461
Transcript NameFunction/comments
Hyaar_Emoy2801764hypothetical protein

Sequence
1989 bases(100 bases per row)
GATAGCTTGCGCCATGCGTCTCTTGACCATATCCGAGTGCGACGCTCGTTTTAAAGGGAAGAGCGAAAGCCTTGCTGGCCTTCACTTATCGCCACTGACA
GAGATGGCACAGCGCTCGAAACCGATGTCCATTACATCGACGATGAAGAAGAAGACGGAATTTAGATCAAAGCCGCTTTAACAGATGCGGATGCTGGACC
CATATTCATCATGCTCAGCGGGTCCGATTACTGCCACCCTCTAGACAAAATTGTATCGCTAAAAATGCTCTCCAAGCGAACTACAGCTAATACGGCAAGT
CAGCAGATGAATTTACACTGGATTGCAACCTTTTTGTCCATTTCGTATAAGTTTTTATCGCGAATGCGGTCGACTGCTAAAGAGAAGCGCTGACAGTAAT
GGAAGCGAAATGTCATTTTATTCAACGAAAGCGACTTAGTCCTACATTATACGGTAACTACACCTAGACACATATTTACTAAGGTGGAAGGCTGTAAACT
CCAGCCAGAATATATTCGTCTATTTTGTTTGTTGTGCCGACTGGGTAACACATACACGATTGAACTGCCACGTATGATGCGCACGCATCCCACATTTTCA
TCGGTCGACTTTGACGTACTATCAGTACGCCGGTTCTTCCGATGAAGGAATCCCTCGCGCTCAACCATCTCCAAGACAAGCTTGTGCTCACGATGCTGGC
TCTCAATCTGCGCCTCCCCGCATCATTAATATAAATATTGATGCGCTACATATTGCTCGCCACGAAGAGAAGTTTGCACCGGCTTATTCTCTAGATATGC
AGAGGAGAACCCCGATTGTTCTTGAGATAAATTTGAGTGGTGACGATTTGCATGGTCCACTCACCAGAGACTTTATTTCCTCTAGGGATCCAAGTCATGC
TTAACTTATGAGTTAAGTGGCGATATAACTTGGAACGGCCGACTCATCCACGACATCAGTCAGAGAACGCGTTTTCTTTTACAGCTCATCGATTGCTTAA
TCCGTGCATCGGTCGACACTTCCTAATGGTACACTGTTGGATTTCCGTAACGTGAGGATACTTCGAATGAATCACTTCGTCAGGTGGAGCGGCTACACAC
CTTCGGCCGAATCTGGAAGTCTCAATACCAAGTGGTGATGGATGTGGTGCAGCAGTGCGACAAAGCACATCCGATGTTGCAGAGCTTCCATGGTAGAACG
AACACCCCGCGTGATCGTGAAGGGGCTATAAATTAGAAATCTGTTCATACATCGCAGAAGAGAGTTGAGATTTCCACCAGTGTTTGGTATGGCGAAATCC
TCCCTGTGCGCGCGTGTCATATTGCTGACACAACTATGTCATGAAGCACCCAATGAAAGGCATAGTACCCAGCCTCTTTCGAAAATCGATGTAACTTGTA
CCATACACCATGTGGCGCTCTCATTTTAAACCTGTTGTGTGCCACAATAAGCTTGAGCGGCCAGGCATTGCACCCAATGTCGTCCATGTTATGAATGAAT
GTGTTCTAGTATTGGATCAGCGAAGGCCCATCACGATTTAGATCTCCGCTGTACCATCCCTGCTCAAAATATCGATTTAAAACTTTGTTTCATTTCGGAG
GTTATCATTTCCCACATAAAGGCCGTGAAGCTATAAGGAATCGAGCAATAATATTTGGTATCGATCGCTTGTCGTCATCGAAACGATACCCTACACTTAC
TGATGTGGTAGCCATTCCTTCCTCTCATGTTTGACACGCACTGCATTGCGATCTCACATCCCGCGCGGTGTCAACAGATGTACCAAAACCACGCCCGTCC
CAATTAGTGACATCGATTAGATAGTCGTGAATAGATTGATCACGCTCCCAATTGGTACGATTACTACACCACCTCGTCCACCCTCGTCTTGTGAATGCGA
ACGAATTGGTCTTTGGCCAAGCCGTCCAATTCGTACAACAATCCTAAAAGGTCATGAAGCTCAGCTTTACGCATGCCAATAGAAATATT