Description :
From Genome Similarity Track
Location :
Scaffold_2:139463- 167723
Transcript NameFunction/comments
Phyta_totarag149conserved hypothetical protein
Phyta_totarag150hypothetical protein
Phyta_totarag151hypothetical protein PHYSODRAFT_509250
Phyta_totarag152hypothetical protein PHYSODRAFT_315971
Phyta_totarag153conserved hypothetical protein
Phyta_totarag154hypothetical protein PHYSODRAFT_354827
Phyta_totarag155hypothetical protein
Phyta_totarag156tetratricopeptide repeat protein, putative
Phyta_totarag157hypothetical protein PHYSODRAFT_507535
Phyta_totarag158pyridoxal biosynthesis lyase pdxS
Phyta_totarag159conserved hypothetical protein
Phyta_totarag160conserved hypothetical protein

Sequence
28260 bases(100 bases per row)
GCAGCCGGCCACCTCTATCCTAGTTTGAGCCTGGCAATTTGCACTCCTCCACCCCCGCCGCCGGCTAGAGGGTATCAATAATGATCCGCCAAGCAGCGAA
CATTCTCAGCGAAGACGGTACTGTACGGTTCGTAGGCGGACCGGTTAGGGTTCACGTCTGTAGTAGCCTATGATTCGTCCAAATCGAACACGTACAAGAT
ATTCAACTGGCTGAAATAAAGTGAATTTCTTTTTTAGCGCTGTAATTGGCTAAAATCCACCCCGAACCGCCGCGGTGGTCAGAGTGTAAGCTTCTTTTGC
ACAAAGCCGGGGATGTGCGGCAAACCCCAAACTCCGGTTTTTGGTCGGTTGTTCTCGGTCAGTAGAGAATTTGCGCTGTAGAAAGCAAACAAGACAGAGA
AAACCAGGTACAGATCAGAACGTaatgctgttgcagtgagTGGGCGCAGCCACCTCATGGCTCGGACTAACAACTAACGCTGTCGCTTGCTGTGGTGTTG
TCTGTTGTGCCTTTGCAGTAGTGCATTTGTCGCGTTAAACCTATTGCCCAGAGGGAGATAGTTCCTCACCCACCCACCCCACACAAAACAAGTTGCCGAG
CGAACCGCACACGCCTAAAAAAGCCGTTTGTGCACGAGCTCCTTTTGTGCCGTTTGTCCACCGTCCCCCTCATCCACACAAAGCACAGCGAGAAGAGGCG
TGTTGTGCCTGTCTGTGCCCTTTTTGAGTGTGagccacttgctgcttcgttgcgcttgcgctctTGCAGTTAGCTGGACAGGAGACATCGCTTGGCTTGG
TTTAGCTTGTCTGCTACTGATTGtcacacgcacacacacacacgcacgCTCAAACGCTTTTTTGTTTAGTAGGTAGTTTTGACACGAACTACTGAAAGAC
AGCACcgtggcgacgacagcagagaCCCAGGAGAGCGAGCAAGTGACAGGAGTGGGCTAACAAGTGGCTGCACACAGGCAAAACAACTAGCCGAGACCTC
TCAGCAATTGTACGTGCGGGACCAAACAAATGACAGCGGAGGGCATGCGTGCCAAACGACGAACTACCTACCAGAACATGCACGAGATCGTCAAGTTAGC
CAAGAAGTACTCGCCCAAGCTGGTGAAAGGCTACAGCGCAGGGAACATTTCTGTAGTGGATAAGAAGAGTTGGTTGGAAGTCTGCGACCGCAAGCACCGG
TATGTTACCCGTTCGTTGTGTCTCTTCGATGCTGAACGGTTGCACTCACTAACTGATGCTTTTTTGTTGATGGAATATAGGTATGGCGCAAATCTGCGGG
CTTACTATAAAGAGTGGAAGCGCCAGCCGATGGAGCCCACGAAGCCGAGCTTCTGGGAGTGGCTGGATGATGAATCaattgaagttgctggtgtACCGAG
AACGAAACTAGAGCGAGAGACTGTGCTCTACTGTGACACAACTGCGGAGCGCCAAAAGTTTGCACTTTCGGTGCAGAACGGCGTGATTGTACATGATGCT
TCACAAGAAATCGTGGAAACAGGACCAGATGGATGGATTTTTGTTTTGCGCGATGGTGTTCTCTACGGCTCTCAAAAGGAGACTAAGAAAATCCCTCGAA
TCCACCATACGAGCTTCGTTGGCGGAGAATGTGTGCAAACGGCAGGCATGATGGTGATCACTGACGGGGTCATTAAAACTATTTATCCTCATAGTGGCCA
CTACCGGCCGTCTGAgtacgagctgctcgtgctgctgcgtttccTCGTGAACAATGGTGTAGACCTGAGCGATGTAGACGTCGACGTGCAGCGAATCCAG
AAGGTGTTCCGCGACTCGGTGAACGGCGCACTTATAAAGAAGTTGGACAACGCGCACTTCTGGAACGCGTACCGTGTATGGTACTTCTTGGAGGAGAAAC
ATCTCGCGTGGAAGATCGGGCTGTTCGACGAACTTGTTGAGACAGTCGGCCAAAAGACAGACATGCATGTGGCACTCGAGCGATCGGAAATTCTAGAGGA
CAGCATCATGGAGGAGATCAATGATGAGTCCTCTGAGATTTCGTTTAAGAATGGCGGGTCTCATGCACTTTCCCTGCTGCACCCCGCTTACGACCCTCCG
ACCTTTGAAGATGCGGCGAAGCAGTTGGCCACGTGCGAGCTGCAGCCGTGAATCGCTGGCCGCGGTTACCCGAAAAGATTTTGCCTTCTTAGGCCaagac
accaccaccaccaccgcacCTTGCCACTGGCAGCGGATACAACACATCAAGCAAAGTATAATGTAATCTAGAGGGACCAGAGACTCGGAGGGGGCTCTCT
GGTGTATTGGTAGTTAGCATATTGGTAGGGAAGacaaagtcgaagaagcaggagtCATTATTGGAGCGCAGCTTGCAGATTCGGTGcgttttattttttt
ttattttatgAATGTACGTTTCATGGTAGTGCTTTGTtcgttcttgctcttctgGCTGTCTAAATGTGTCTTCCTTTGACGGCGAACAGACGTTAACTTG
AAGCGATGGCGGAAGGAGGCAGCAGTACAAGTAACGTTAACGACGGTGCTCGGGGTAGCGgagctaccggtagtgcTGACGGGAACTCGCTCCCCACAAA
TGATGTCGGTGCTTCGGTGTTCAGCCAGATCCACGTCTCGTGCTACGTTACGGCAGCGAATCGCGCCACTCCAGTATTTGAGATTCTCCCGCAGCGGAAT
TGCGTGCGCGTCGTGAACAAATCCACAGGCGATACTTCAATAACAGAGTTGATGTCAACTGGAAAtaccagctccagcagcagtgctgggCCTTCGGCTG
AGTGGGACTTCCACTCAGTGTTCTCGTCAAGCTCGCCTTCACACgccatcgacttcttcactGAGATCACGTTGCCTGCTTTGCGTACTGCGAGGAATGG
TATCAACTCGAACATTGTTGTGTGGGGTGTACATCCTACGCAGAAATTTCGGTTGTTGTTTGGAAAAAGTGTTGGTGGAGGGGGGTTTGCTCCTCGACCT
GAAATGGCGGTAAACGACGTTGTGGAGCTGTACGGCCAGTTAATTGGGATGCTTCATGCATTTTTCTCTCAATTGGATCTGGGATCTGGAAATAAtgctc
gacagcgacgagatACAGAGCCTTGGAGACTAGGAATCAGCAGCTGGATCATTGTAAACAATCAGGCGATCGATTTGTTGAATACTCCGATAGGAGGATC
TCATCCCAGCGCAAGCGGAATGTTTTCTTCATCCGTTCAAGCCCAACCTCCAGTGTCGTTTGTTTCGCTGGAGGCTCCAACTCTCACTACTGCTTTTCGT
ATTGTGCAGACTGCGAAAACTAATCGCATCGTACGCAAGCAAAACGCAGAAAGTGTCCACTTTTTCGTCCGTCTAGCGTTATTTCACGACGGCCAGGTCA
GCACAGTGCACCTTGTTGATCTAGTCGACCAAAACGATTTCCAAGATCACACTTTGATTCAAGAGAAGGTTGAGTTTTACAATATTCTGCAAGGCTTGAG
ACAGCCTCTACTCTCTCCGAGGCAAAGCAGTAGCCGAGCTGCCACTACTGGTTGTGAAGTTGCAAGTCAAATGGGTTCTGCTGGAAATATGGTGCTGTCG
AATTTCATACTGCCGTTGTTGACCGCGAATGCCAAAACTTTCCTGTATGCAAATGTGATCGACTCTCGCACTAGTTTACGAGAAAGCGTGCAGATGCTGA
ATGCTGTGGCTAACCTTCGAGGTTTCGCGTGTGTTTGCAAACCACTTCGTGGCGTTTCTTACGAGCAACTGTGCTTTCAGACTAGCTCAAATGAGCAGGA
GCGAGAAGAATTTCCAACCCAAACTGTGCAAGCAAATTCAACGTCTTCATTCGTGGCACCACTTGGCTCGCACCAAGTCGCAACAGCTCCCCCGTCAAAT
TTATCCACCACTCTGGAACAACAATTTTCGTCCCAACGAATACCGAcacctacatgtagtggaGGTGGCGAGTCTGAGGCTATGAGCTGGTTGGATGCTT
TCACTCAACGGAAGCGAAACATCCTTGGTGGATCTATCGACAGCATTCCTCCTGCAACAACGAGAACATGTATTGCAGATCCAGCATCTTTACCAGCGTT
TGCCAATGCAGAATTTATAGAGCCCCAACAAAATGGAGCCACACCGGAAGCGCGATCGTCCATAGCAGATCTATACGAGCGTTTACGCGAGTCCTTGGAG
GAAGTCAACGAGATTGATCCCAGCATTCTGGCAAGTCCACGGGCAGCGTATTGCCCGGTTTACTCAGTGACACCTGAGCGTTCAAAGCCCGAGTCAACAG
CCCCATTGCCCATTGTTGATCATGATGCAAACCAGGATGACTGTGTGCAGACTGGGTATAGCAGAAGCACGATTGGTGGCATTACCCGACATCAACCGCA
ACATTCGCAGGATAATGAAGATCTATCTGCGTGGGCCGAATTGAATCACGTAGCTATTGATCGGCCCGTAGATTATTTTCCACCTAGATATCGTGAGGAC
ATTGACGCTCATACTCCAAGAACCAGGCCTGAGAGAGACTCGGTAGAACCAACAGAGATGCCTTCATCGCCTTTTTCGTTAACGCCACCAAGTATTATCT
CCTACCCACTAGCGCCATCAGGATTGGTATCGAAGCCTGACAGCTTTACGCTGGAAGCCTTTAAAAAGGCTGGGGTTCCTGATTGTGTAATGGAACCTCC
AAACCTAGACGGCCTGGATGTGAAGACAGCGCAAAAAATCCAAGCTGCCGATGCAACGTTGCTCCGCAAGAACTATGACGCGCTACTCTCGATTGTccgc
gaacagcagcaagcgaaagaagcagcagaagctcgtgcAACCGAGGCACTACACGACCTTGAAGAACTGCGAGCGATGTTTGAGGTACAAATTGAAAACA
TGAAGCTTACAAACGTTGGACTGCGAAGTAAAGTTCGTGCGTTGGAGAATCGCACGTCGTTGCCTCAAGTGTTTGAGCAGTACGAGCAAGAACTTCGGTC
ACTTAATGCCCAGGTTCAAGAATTACAGGCTCGGAAcgtcgctcttgagctccgGGTAAGAAAGTTTTGGGGTTGTCTGACGGTGGTGAATCTATTGTCA
TGCCTCTAACCGATTCGTGTGTAAACTTACAGACAAGCAGTTCTGATGGTACTTTGGTTAGATTAAATGGATCGTCAACTGACTTCAAAAAGAAATACCA
GCAAGTGGTGGACGAAAAATTAGCGCTCGAGCGAGAAGTGATGGAGCATCAAAGGAGGGAAAGGTAAATATTCGCGTCAAGCATCAAGTGTGTCTTCAGT
ACTATTGAACTTACATACTGTGGTTGTTGACAGGCATCGCCAAGTTCACAGTCGCCTGGCGGGCGAGTCTACTCGACGCGTAGAACAATTATCGCGGTAC
GTAGTGGCAAGCCTTGTTGAACGGCAGCAGACTAGCAACGAATGACCTTGATATGAAAAATGACCGATATGCTGCTTTGTTTTAGCGACCTGAACAATAA
GAACGAGGACCTGGTAGCAACTCGACTGAGCCAGAAGCGCTTGAACGCAGAAATGAACCAGGCTCTTGAAAAAGCGGATGAGTTACATCATGAGAACGCG
AAGTTGTTGCAAGAGAaagcggcgacgacggaagAACTTCTCGCCACCAGGATGTATTTGGCCTCGCTTGAAAACGTACGTGGGCTTCGTTTATGACAGC
GCAGTTGAAGTGTGCTGATATGTCGTGTTGCAAATGAATTCtacaggagaagaagaaggcatcGATACTTGATCGCTTCGTCGAAAAGCATGGTGATCGC
ATGAACAAACTGCGTCAGCATGGgcaatcgtcttctgcaACAAAAGGCGAAAGCTGGCGCCGCGACCAGTACGCTCGTGAGTGCGAAGACAAGTTGCTTG
CAACAGTCAAGCGGTCACTCCCACAAGCAGTGCCGCTTTGCAACAAATTGTTACAACGGCTAGAGATGCAGGAATTGTCGTTGCGAGAGTTCTCCGAGCG
TGAGGTGGACTTCATCAACCTtctcgtggagctggtgtcgGACCAACCCACCGTTTCACTCAAGCACATGATAGagcaggagatgaagaagctccaaACG
TGCTAGATAGAATACATCAAAACGATTGTTTGTGTTTGGCAAATGCCaaggagagagagagcaacCACCTCTCCACGATTCTGCATTATTTGCACTTGAG
CCATAACGCAGTATGCGCGGCACCTGCCAGACTTAACTGTGTGTCTTTCCTTCTCTCTACGATAACAATGCTCGAGATGGTAGTGACCTTCGGGCGCTTA
GTCGACCTGGGCCATAGCAACGTCCTGCTCCGTGAACTTGCCCTTCTCGGTCTCGCTCACGGCGCGGTTCTTGCGCTCCAGGATTTTCTTGCGGTCCTTG
TCAAGCTTGATCTTGGTGATAACCACCTTGGAGGCGTCGACGCCAATGGGCACCGAGGCGCCATTGGCCTTCTCACGCACTACACGCTCGACGTGGATGA
CGAACTTCTTGCGGTACACGGCGGTCACGCGGCCCTCACGGGACTTCTGCGAGCCACGCACGATCAtgacctcgtcctccttgcgGATGGGCAGACTGCG
AACCTGAAATTGTCAATTGAAAACTCACAGGATCCATGAGCTAAAAATCACACTAGCGACCTGGTGAGGGTGCCAtagttgctgtcgtcgtcctgtgGTC
GACACTTACGGTTCCCGCGATGCCATGAAGTGCCAGTCTGCCCCCTCTGGGGTAGAGAGGGGCAGAGTCTGACATGGACTTACAGCGCTGAAAGTACCAG
TGTACTAACTTACATTGTACttgttctgcagctccttggaCAGAGGCGCGCTCATGAGCACACGACGCTGGGTCGAGTGGGCGCCGAAGTGGGCCTTGCG
GCTTTTACGGCGCGACGAGGACACGGTCGAGTTGAACTTCACTGTAATTCATAATGTAATAAATACCACACGAGTTAGGGCACTTCGTTCATTGCTACAG
ATAGAGACATTTATTTGAAAaagcgacggcgacgcacTCTTGTTATCACGTAAGAAAAGAGATACTGGACGCTGCGCTAGTCTTGGCGGCGTGGAGGGGC
CTGGAAGCCAACCAAAATCGAGCGACTGAGGTTGATTTTGGCGGTTAGTTAAGACGGTTAAGGGGTAGGTGATATTTGGACCGGTTATTTGGTAcggtac
actgtaccattGTTGGATAAGACGttgatgttgaaggtgttggAAGACGTTGGTGGACGGATTCGTTGGATGAAGACTAAACATTGCACCGATCAAATAT
CCCTACGCATATATTGATTGCACGCCATACAGAAGGCCTGGTACTCATGGCAACGAGAGGCGGGTTTTATGAGGAGTTTGCAGACTGTTTCTTGCCGACC
GACTCGTGTTGCGCACTTTAGTGGGCACCACCAACTTTTGCTTTAGAGCGTGCTGTCAATGTGGAGCAAGACAAGTGCGAACGTtagctgcttggccttg
tgATACACGTAGAGGGGAGTGAGAATGGTAAATGAGCTTACCTCAAGGATGAGAGTGGCGGGCTCGGTGGCGGTCTGCACGCCAGGGTTCTTCAGGATAT
CTGCTGCACTGGGTCTCTTGCTTGGATCGGGATGCATCATCTTCACATTTACATCGCGAATTAGCTACAACAGTCATTGAGATAAACGCAGCCGTTTTCG
TACCTGTCGAATCATcttgttgagctcctccgtgTATTCTGGAGAAAAGGGAGGTAGATTTCCTTCTCGAAGATCATGCCACTCCTTCCCAGCTTCTGGC
AGCGTCACTCCTGTAGCAATCTCCAGCATCATGATGCCTGCAACACCCCAGAAGCAAGTAAACCATGTAAGAACCAGCACACTCGCAAGATTTGCTAGGT
CTCAGCGTACCTAGACAGAATATGTCCGCTGATGGAAGGCGGGCAGCGCTGGAAAGCAGCTCCTTTGCAATGTACTTTGCATCCCCTTCGAGATCTCCTA
TCCGACTCGACGTTTTGGTCGATGTTACCACTTTTCCCGCCATACCGAAGTCACCAATCTTTAAATTCCCGTCTTCGGTGATAAATATGTTGTCAGGTTT
GATGTCCAGATGAACGCTGCCGTGTTCATGCAGAACTTCCAGTCCACTTGCAACATCCCTGAGAATGCTCCACAAGTAGTTTTCTGGGAGTGGATCTCGA
TCCCGCTTAGTCATAAAATCTTGCAGCGTGCCGCCTTCACATAACTCCATttgcaagaagaagaagcctgCAATTAAGCACACGGACAGTTAGCAAGCAA
CGCAATAGATTTTCGCATCAACAAGAAGATAGTATACCGTTCTCTTGCCAGGCTTGATAATACCGCACGATATTGTCGAAATTATGTCGTGACGTGGTCA
ACTTTTCCAAGGCGAAAATTTCTTGGGTCAGGAGGTCTCTGTAGGTAAGGGTAGAGTAAGACAACTATCGATAGCAGTTCAAAGAGCATCGCTAGTGTCT
GTCGTACCGTTCTCGGTTGTTTCGCAGTTCTTGCTTGGACTTTTTGATGGCAAAAAGCGCTCCACTCTTTGGATCTCGAACCTGCTCATGGCAACCCAAG
CACGAGTGAGTCAATAATCACCACAGAAATCTGATTTAAAGGAAGATCATTACCTTGAATACTTCCGCCGATACGCCTGCTCCAAGCCAACGAATGGTTT
GCAAGCCTTCAAACGAAGTAACAAAGTGATTCTGTACGCAATTTGAAGGCCACAATAGCAGTTATCAAAAACCGATCTCTCATCAagcacaacaccaaca
aaaGACCCACCGGACAATCTGCAACACTGAGCATTTTCAGCACCACCTTCTTTAATTGTGGGTGTAGCCGAATCGCCACGGGACTCGTCACAGATAACGT
CGATCCAAGGTTACTGCTCAGCAACGTTGCCGGACTCGCACACGGCGGTGAGACCGATCTACTGCATCTGACATCCACCACCACATTGCAATCAGCCATC
ACCTTAGCTCCCTCTCTTTAAACTTGCAGTAACGAACCTCCTAGTGAGGTTATGTCTCCTGTGCGACGTCGGCGTGCTCTGCTCCGAACTGGATCGCCGC
TGTTGCGTCTTATTAGGCGACTGCAATACACGTCGACGGTACGGCGGATCCTGCCTCCCGTACACATCCAGACGCTCCATGCGACGTGTGCGATAGCGAA
AGGTGCCTCCAGGCGCCGCCACTTTACCGTCCATGGGGCTCCGACAGGATGTATCATCGCTGTTGTTGCCATTGTGCTTCTggttctcctgctcctcttc
ttcgtcgccttcatcgtcgtcttcccTGCTCATGAAGCTGAGCGTCTTGCTGACacgtggagatgaagctTCTTCCATTGCTGCATGCAGAGATCGCGCC
CGCGACGGCGACGGTGACGGCGACGCGAAGTCTCGCGCCATTTTCCTCCCTATTTGCCGCCAAAATAGGTATAATTATTTTTGGACCAATCACAAGTGAG
TTAAACTGTCCGACGGTTATTTATAGGTCCAAAAAAAACTGAGGCTAAGCTGAGCTTTTGAGAGCTCATTGCAGTTCAAGGAAGGCGGACGCTCGAGATG
CTTGGCAGGATCTCACACTGGCTGGCCACGCGGCACGACGACAAGGGCGGTGCCAACGACGCCTTTGTACAGCAGCGCTACGACGCTCTTGTACGTGGTC
GGAGCTGTTGCAGTTTGTGTGTCTGTCTACAGAGATGGGGAATCTGAGAATACGTCTCTGTGGTCTGTACTGTAGTCGCGGCTGAAGAACGCCACGTTGG
CGGTGCTACGCAGAGAGAATGCTACGGAATCAAACGATGCAGGCGGCCAAGAGGAAGTTGCCAGTCTGCAGGAAAGTTGGGCGACTGAGTCGCTGCCCAg
agagcagcgccagcagttGACAGAACGCGACTCTTGTGTCGGCGAGCTCTGTACGTAGTTTTTGTAGTGAATTTATAGTTTTTAGtggaagatgttgaag
tttgtgGGTGATTTTGGGCAGGCATGGCACTGGAAGAGTGTTTGGTGCTGGGGCTTAAGCCGCGGGGTGACGAGGAGCAGCCGTCGTGGTGGCACGTACT
GTATGCCAGCACGCTCATTGTCGACGAGCCGACGCTGGTGCAGAGTGTGCTGTCTGCTGCATTCCTGTCGGAGGTTTGTTTGGTGCTTATCAtggtgttg
ttggtgttTTGGTTGCACTGGTTGATGAGGTTGTGCTCGGTGGGTACTTGGTGATTTGATAGACCGATGCAGGGAAGGCACGATGCTGGCTGAAGATCGC
GCTGAACAATCATACGATTGAGTCGAGTATTATGGTAGGCAGTAAAGTCCGCGCTCTGATTATCTTGCAAGCTGCTTACAGTTAACTGTTGGCGGCTTGC
GTTGTACGGCTGTTAGATGATCTTTTCCATGGCGTGCGAACACCTGATCCGCAACAACTACGAGGAGAGGTCGCTTGTTCGTTGTTCTGAAGGATTGGGT
CTATTCCTCGAGCTCATTATCGCTCTTCGAGAAGTGCACTTCGCAATTGAAGTCAGCGGAGAGCCGTTTTATTTGCCGGAGTCAGCGGAGTCAGTGGAGC
CAGAGCCTGGTACTGAGAGCAATAGTGGGGAGATGGTTTCTACTATTACAGATGAAGACATTGCTGCGGCGGTGGGGGCATCACCTTCCAGGGCTGGATC
ATTTTTACCACCCCCAGATACCGAAGCAGTATTGGTCGAGATTGAAGACGCCAAAGACGTGGAGATCCAAGAAGCCGTGCTGGTAACTGAggaagtagaa
gaagaagaggttATCCAGTTACCATCGGCCTTATTTCCCCATCGCCTCAAGGGCATTAAACCGTGGCAGTACGTGTTCGGCGTCAGTCTGGCATCCCTCT
CGAAAAACCCATACCACAGCCGCTACGCTCTGATTGACCCACTGCTAGCGCTTCCGAACATTGTGGACGATTGTGTTGCGATACTGAGGCAAAGCCCGGA
TACTCCACGATTGTTTCGTACGACAGTTCTGAACATTCATTTGAACCAGCTCCGAGAGATCGTAGAGACCGAGGGGTCGGTACCGGAAGATCTGGATCCg
caaggtgcaggagcaTTACTCTTAGACTTCCTGAAGAACCTGCCAGATTCATTGTTGACGGACGACAAATACGATGCGTTCGTGGCAGCTGGGCAACTGC
GCGATGAAGATGCCAGCGTGCGCAACATCACATGCTTGGTGAACGACTTGCCTGTGCACTGTCAGATTGTACTGAAGAGAGTGATCAACCTGATGAACTT
CCTGCAACAGCCCGAGTATACTGAACAAAATGGTGTGGACATTTTTACGGCTTCTACGGTTCTAGCCCCCGTAATTGCCTTTAAGAAAAACACGGGAAGT
GGTTTGTCGTCCGAACGTCCGCGCGGCAGAACGCATTCTCAGTATCAAGACGTACGATATGCAGCAGTAGGTGCCCAAGTAGTGGAGCGGATGATTCAGC
ACTACGCGACCATTTTCCACTCTGTCCGGGTTCAGGTTGTAGATGCACTCGAGCGATTAGAAGCCAAAATGGAAGCGCTGCGCATGGTGTCGCATCAGTT
GAAGCTTCAGCCGCAGATGAATTTCTTGTCGGATAGACAGCAAGTGAACGAGATTTCTCGATTGTTCCGCCAGCATTTAGAAGGAGGTGATGGTTCCCCG
CTGTCTGCTCCAGACAGCTCAGCCACTGGGCAGGTTACAGAGTGTTCGAAGACTGAAACCGCAGCAGATCTGGAGAATGAATCTCAGCTAAACACTGCCG
TCAACCCAGAGCTAGACTTACAGGGACCGACAGTTGCCACGCCACCAATCAGCGCTACCAGTAGCGGGGCATCTTCACCAACCAGTGAAACAACAGAACA
GGATCTTGTAAGCGTCTGGGAGCAGTTTGGTTTTAACAGGCCAACCATCTTAGGGAACTTCGAGAAGGGTGGCGTGCTGATGCTGCGAGCCATTTTATAC
TGGCTGAAAAGTGACCCAGACGCACTATCCCTATTACAGATGCGTGCGCTGCCGTCTGAATTGCCGTCTTACGACGCAGGGCTGGTGGCGTCGTCTATCT
GCGAGtcgctggtgaagctgctgaaacTGTTGTACGTAGTGCAAGTTCTTGGCTCTGTGTGTGCCTACGATCTTACGTGTAGCTGACCCTTTTTATTCTg
tttgcacttgcagcttAACTCCGAAGCACCCGGAGATCGACATCATGGCAATGTCATTGGAACCCTTCTGGGAGCTGTTTGACGAAGACATGTATTTCAA
CAAATTGTTCATGTTCATGTTCCAGGTGTTCGACCAACTGTGGAGTGAGCTTGACCCAAAGGCGGCGTCTTTCACTCGTGTGATTACGGAGACTGAGGGT
ATCATAAACgagttgctgaaggaggctCCAGTCACGGTGAATGATCTGCGAGTTGAATGGGAAGAGATTAGGACGCgtcgccatgaagaagttgaagaag
aggaggaggaggaagaagaacaaggagagttggttgaagatgaagcgctCCGTATCGCTGCCCTATCAGACCCATCTCTTTTGTCACCTCCTTTGCGCTA
ttccaagaagaagcctTCCTTCGATCTTAAACTGGACGACTATAAGTCCAAGCTGATGGATACGTCAAGTATTTTGACACTGGAGCATATCGCGTATATT
GACCACGCGTTGCCGATAACAAGTCAATTGTGCCGGTGGTTTCGGATCTACAGTGTGGAGGCAAATGGATCCTCATTGCAGACACTGCTCATACtcgcga
agaagcagagccCGACGCTGTTGGTGGTCAAAGATGCCGAGGGAAATATTTTTGGTGGATTTGCTTCGGACGAGTGGCATCACGCGTTCCACTATTACGG
CACAGGCGAGTCATTCTTGTTTTCATTTGCGAGCTCGAGTCCTGCGGGTGGATTCGTGAAGTACCAATGGAGCCGCAAGAACAGCTACTTCATGCTATGC
TCAGACGAGTCGTTAATTATGGGTGGTGGGGGCAACTTTGGCTTGTTCCTGGtgagttgaagtgcttgttGATGTATTGGAGTTGTGGGAATTTTTTATG
ACTAACACTTTATGCTGCTCGGCTCGTCAGGATAGCGATTTATCTGCAGGGACTAGTGGCGCGTGTGAAACGTTTAATTCGCCTCCATTAACCACCTCGC
AAGAGTTTTCTTGTGTCCAAGTCGAGTTGTGGGGCTTCACAACAGGAGACAAGCCCGTTGAACTTGGTGAACGGCACAGGAAAAGTGTGTTAGACTAGCA
GCAAGGAACGTACGGTCTTTATCGGTCAAAGAACAACAATGACATATCTTATTTACTCAAAATCTGGGAGATTGATTGCACGTAGTACAacttgtactgt
acatgtacaagtacatgtagtgaaAACGGCGATACTTCAGCAGCCCGTCCTTAGCCTGCTGTGACTCGGTTCTGGGTTGCCAAGGTAAATGTATTCTgcg
agaaaaaaaaatatcGGAAACGCTCGCCAATTCATTGCAAACTGAGGTCGCCATTGGGCTGCGGCAGCAATTGACAGTCAAGCTCAGCCTCGAATCTCCG
GAACGGAGCTTCGACAGATTCACGCTGTAAATTTAAACAACACAAATCGAGCAAACGTGTCAACAGTTGCGATGTTGCATCATGTGTAAGTTTTCAATTT
CGACGAACCTCTTCAGCGGTGGGTGTTGCGCTCGCTTGCAACTGCGGTTGCAattgctccagctcgtgctcgaATAACTCTGCAAATCGTTGCAAAATTA
CCTGTAGAAACGCCTTGAGCGCGGCGCACGCTGCATCGGAAGTCCGATCATGGAATAAAACGGCCTGGATGGTCTCATTCTGGAGCGAGATCATGACGAG
ACCGCCAGAAGAGGTCTGCACAATAGGAAAATCATGGTCAGTTGCTGTAATAATTCTCTAATAAAGATTATAAAGTGCCTACGGGCATTGGGCTGCTGCC
GGATCGGTCCTTCTTGTCAGTTCTGCTCGGGTCGAAGTGCACCTTCACGACCTCTATTGAGTTACAGTTACAGCATACAGTTAGAGAGCACATATAATAA
TCCATACAATAGTCGCTGCACGCCGCACCTCCGCCGTCGATCTCGCGCGCGAACTGCGTGAAGGACATGACGAGCGCGTCCACGCCCTCTGCGTGCGCCT
GCGGGGTCCACTTCCACTGGTGCGTGAACAAACACACGCCAgactgctgatgcagcaccttgacCATGCGCAGCTCCCCAAGCAACGCGTTCATCGTCAA
TTTCTGCGAAATAGGCTAAAGGCTGAACTCTAGCTTGGTGTCTAGCTTCTCCTACAAACATTATAGTGTCATCTGATACTGCTCTTTAACTGTGCCAAAG
AAGTTCAAAGGAACTTTGACTCGAGTCGTGCAGCATGAGTGGCATGAAGGCGACGTACAAATTCTACGGCGAGGTGGTGCACTCGTTTGAGAGCTTCCCG
AGAGCCACCGAGGCAACCAACGAGTACGCGCAGGCGTCAGGagaggagaagctcaaccACTCGTACTCGGGCAAGATGGACGGCGGCAATCCCATGCCGG
AGCTCAAGGCGACTGGCCCCTACGCCGCCCTGGTCACCTCCATCAAGGTGCCGTCACTGCACTACAAATGCAAAATGCTCCTAATACACAATATTTTTAT
TACATCACTAACCGTTATTATAAATTGTTGTTTGGTTTGTTGAATTTGCATTGTATTGCAATGCAGCGAGCTAAGGAAGACAGCGAGGGGTTCCTCAAGG
ACCGCGTGGAAGGCCCCGTGCCGGCCAAACTCTACAACCAATAAAATGAGGCTGcgcgctgcacttgccgTGTTATCATTAGTTTTAtttttcattttca
acaaGCACGCGTCTTATTTTTCATTAGTTTCTAGGCGAAGACATTGACGAGAAGACCACGTTTTTCAAATGACAAAGCTACAATGGTGCTGAGTATCAAC
AGCTCTGGAAAATGTGCGCGACCATTCGTATCGACAAATGGGTCGCATCTTGAATAAGAGCGTCGCCGTCTTCAGTACTGCTACTGCTCGGTTTCGCCCT
CATCGCTCTCGTTCCACACGGGTAGTGGCatgtgctccagctcgcgatAGGAACGGTCCATGGCTTTATGTCGCTTCTTGTAACGGCGCTTGGTGCGAGG
CGCCGGGGCATGGAAAATCTTCTTGAGGCTCGGAACCTGCGGTGCCGCATGCGTGCGCAGGTGGTGGCCAGCGTAGTCGGTTTGGCTGCTTCTTGTACCT
CTAGCAGCGACGATTCCTGTGTCGGACGCCTCCGAAGCCTTCTGAAGATGCTTCGGGTTTGTGCACTCGGAGCAAAACCATGGGATTCCATCCGGAGCCA
CCATAGCAAGGTTCGTGCAGTTGAGATGGAATGCGGCAGGACAGCCGTCACAGCAAATCAGCTCGCCAGCCAGACCGCAACGAAAACAAGCATCCTCGTT
CAAGTCATTCTACATATGTCAAATAACCATAAGTCAGTGGGTTGTTTCGCAGTGATGAATGAGGTGCACGTCCATCCAGACAGAAATGTACCTGGTCAGT
GTTGATGAAGATCTGCTTGCCCTTCACACGATCAATGAGACGGTGAATGCGGTCTGGATCGATGGTACTGGACGACGGGATGCGCTTGTTCCACTTAGAG
TTGCCTTTTGCGAAGGCTGCAAGCTCATCTATGCCGCGTGATCGTGCTTGAGAGAGGCCTAGGCGACTGTGAATGAGCTTCGTTCCTAATGAAGCACGCT
TTGGATGCGAAAGCACCGGCACCACCTTTTTAGGACGACCACGCTTCTTTGGTGGACGTCCTGGACCCCTCTTCTTAACCggtgaggaagaagcgagtTC
TGCACTGAGATCTGCCGTGAGGTCTGCTGTCCAGTCAGACTTGCCTCCGCAGATGTAGCTTTGAAGTGCCCTCATTTCAGGCAAATGCTCCCCCGCCAGC
ACCTTTTCGTACCAGGTGCTTTTTCGTGGCTTCTCTTTAATGAAGTTGATCTGAATCGTTTGTGGGGGCGTGAGCGAAACATCCTCCTCTGTCGTTGTCG
AGCATTCCGAGGCTGGACTGCTCGATGGCAGGCTACAGCGAGCTTCACCGTTGTTTATTATGTCATCAGCATCCACCTTATTAGGCCGGTGCATTCGATG
ACTGAGGAACAATCGACGATTCTTGAACCCGTAATATTCCATCCAGCTATCGACCATCTGAGAACTTTTTAGCAGCGCCAGTGAGGTCAAGTGTACTGGC
CGCTTAAGCTCAGGTGGCTCCTCATCCACTGGTACTTGCTTTTTAGCCTTCGCGGTGCCCACCACTCGAGGATTGAACAAGGGAAGCTTAGACCGCTTGA
GACCAATCTTGCCTGTGCACGCAGTAGATCCACATTTACAGTCGGCAGCCTCACCGAAATGTGAGAAGTTGTAGTCGATAGTGATCTCCTCGTTGACAGC
GATGTTGCGACGCGCAAAAATACCAATACGCTGTATTCCGTCCACATTCCTGTTTGAATGCACACCTCAGTGGGTGAGCCGCCATGCATAAGTCAACAAC
ATGTCTGAGGTGTAGAACGTACCACTTCTGTGTAACGCTGTTGGGGTCGCAGCTGTGGTTGATGAAACGCGACTCATTACTGCGGTACTTCGCGTCGATC
ACAATGTTCTTTTCCAGCTCCATCAGATAGAAATTGACCTAGCAAAGCGGTGACATCATCAGTACACCGCAGAATCAGCAGGCCGCCCATTCATGTCACT
CACCTCGCCATTGTCCCTGTACTTGACCATCCTGCGCCCGCATTCGTCATCATCAATGACCTCACCGACGTATTCGATAATGAACTCTCCTGCATTGATC
TTCTCGTTAGCAACGAGTCCGAATCCAGGACCTGGGATATACTCCACTCGCACCGACTTGAGTTCCCTCCTCTTAATAGCCCGGTTGCTGCACATGCTCG
GGTCAGGAGCAGAGCACGTTTCGTCCGAGCAGCTAATGAAGAGCATGCGGTTGTAGCACCCTTCTCCACAGTACACCATGGTCTCCAGATCTTGTTGTTT
CTCTAAGTCTGCGTGACGTGTCAAAGGACAGTGTCCCTTGaccgccagctccttctgaGCCTTTGCACttgccatcatcgtcgtgcGCTTGGTCATGGAC
TTGTGGGTCTCCTCACAACACGTACATTTGTGCACGGGGAAGTCGGCAATGGGCATCTTTGTGGACACGTAGACGCAGCGACTGATTTTGCCAAAAGGCG
GTGGACGGCGCACCCATTGACGCTCCTCGAGACTCTTGATCTCCGCCTCTTTGAACGGCAATTGGAACTCCACGACGCGCTTCTCGAGCGGAGATTTGGC
GGTGCCACGTCGCTTGGGGAGAGTCGGTGGCGGGGGCGGTAGACGGTGCGTGGCGTcctccaggagctgcaggaagctcgtcgtctccaggTCCAAAGCG
GGCAGCGGCTCCGGCTCGGGCGCGAGCTCCTTGACTGCGggctttttcttcttcggtgGTCGACTAGGTCCGACGACCTTCTTGGGCTCGTCAGTGGGCG
TCGTGGCATcgagcttgcgcttcttggcggccgATGGGCCCCGCCGCCCGGCCTGCGTCGGAGGCATTATCCACACACTTTTGTACAGTGGCAGGGGCGG
TTGATTGGCGACTGCCTCACGGGCGCCAAAATCGCGCGTGACTTGACGTTTGTATGGAGATGGGTGACTTCATAACGCGCGAATTTGGCGTTCGATTCAA
ATCATTAACGATTTGTGATTGGATAAAGTAATGTCTGAGAAAGCATATCATTGGATAAAAAGGAAAAGGAAGCCGTTATGTTGCGCACCCCGTCCTCTGG
CTGAGGACATCTACTGTATCATCTACCCTGTCTACAGCTGCGCTTCCCTGGCATTGACCTCGTCCAGAGCGGCAGCGAGCGTCTTTACAGCATCGAGCTC
TGTGAAGTCCacctgcgccttcttgagcacgccGCGGATGTACAGGCGGCACGAGtacagcgccttcttggtgccCTCCGCCAGGTAGTCCTGGGCCAGT
CGAGAGGCTGCCACACACAGTtcctccaccttctgctgTTCACGCTCCCAGCCGGCAACTTGCAGGGCACGACACTGCTTCAAGCGGCAGTCGCGCGCTT
TGTTGGCACGACCCTCCACGCCGTCGTTGAAGTGTGCATACACCTGCCACACCTTGGCGTCGGTTGTCACGATGGACGTCACGCGGCCAAAGAGCATGGC
CAGTTGCTTCTTGTAGTGCGAGTCGGACCGTGGGGGAGTCACATCGGTGGCTGCCACCGCCTCATCGAGCTCTGCcaagtcttcgtcgtcgtcgtcgatc
cgGTCGACtttgtcctcctcctcgtcagcaTTTCCGATTGCGCCAGCTTCGGCATCAGCCTCTagctgcatcatcttcaggGATTCGGGATACACAATGG
CCTCCACGAGCCACGCCAGCATTTCGCTATCCACCGGGCGCTTGTGCTTGGCACGCATgtccagaagctggtgcaTGGCGTACATGGCCTCGCCGTAGCG
CTTTGTTTCCATAGCGCACAGCGCGTAGTTTTCCCGCATCTGCCACATGTGGCGCTTTTGCTTGAGCGCCTCTTCCAGCACCGCGAAAGCTTCTGCATAA
CGCTGGTTGTGCAAGTGGATCGAACCTAGATTGCCCCAGGCCTCACCGTTGTCCGgctcaagctgcaccacGCGCGTGTATGCACGCATAGCGAGTGCCC
AGCGGTGCACACGCATCGCGATCGCGCCGAGAGTGAACCAAGCGCCTGTATGCATAGGACCCACGTGCACGGCATCCTCGTAATGGGGAATTGCTGCCTC
ATGGTCACCCTTCTCGAAGTAGTAGCGTCCCAGCGAACGCTTGGCGCGAGCGAATCTCTGCTTCGAAAGTGTCCAGGACGTCTCGTAGTGCGAAGGGTCC
TGGGTGAGGTCTCCGAGCGTGACCCACATGAATGGTGTGGGGGCGATCTCCAGGCGCTCGCGTACAAGCTTCTCAGCGCGCATTGGCTTGTCCAAAATCT
GGTAGCACTTAACGACGTCATCCCACATTTCCAGCTCTTCGCAGATTTCAACAGCACTGCCTAGAACACCAAGCTTGAAGTAGCGCTCGGCCAGGTCGCG
CTTGAGGGCATACCGGGGAGGGAAGGCCAATGAATACACAAACTGCATGCGTTcacgagctggcgctgagTCCGCAATAGACTGCAGCGTATTCTGCGTG
ATCGTGAGTCCCGTGGTGTGCTGGTCTACCAGGGCCTGCATCTGCAACACAGCGCGTTCACGGCGTTTCGAACTCTCGCACTCGAGCCACgcgcgctcca
gcagcgccgtggaGTACACCATCCAGTTGTTGGGGTTTTCAAGCACGCGCGTTACGTAAGGCATCATCTCTTCTCGGGTGAGGCCGTCATTGGCGTTGCT
GTTCTTCACGTCTAGGCATAGTCCTAAAAGCACAATCTGGTCAACGATCTGCAGGTTACCCTGTTCCGTGAGCTTACGGTCCTCGAATGCAATGCTTTCC
AGAAGATAATTGTCCTGATCCACTTGGTCCAAGTTCACATTGCGATAGGAAGCCATGCCTTCCTGCACAAGCTTTTGAATGTGCTCCTCGTCGGCCGTAA
GGCTGTCGGCGGGAGGAACAGCGGGAGATGCCGCATCGTTTTCGCCTTCACTTTCTGCCGCCACCTGCTTACCGCCAAAGTCCACATGAGTCGATTCAGC
CACAGCCGTCGCGTAGATGGAagcttcttcgtccacaCTCGCAGGCTCTTTCTTCGATGCCGCGAGCAATACCATCTGAGCCAAACTCTTCTGCTGGAAT
TTGGTACGTTTACCCATGGACCCGCTGAGCTGCACACTCACGCCAGAGATCTCCTTCGCACGCGCGAACGTAGTCTTGCCAtgcttgttcttgtcgaagT
GATGCTGTGCAAGGCCCCACTCCACATACGCACGAGCGAGCAAGTATTGTGTGTCCTTCTCAAAGGCGAACAGTTCGGTCGTCTTTAGCGTCTGGATGTA
TCCACGACGAGCTTCAAACCATAGCGTGTTAGAAGGCTGCTTTGAAAGCAGCAGTCGTTCATGCGCCACGGCAGCACGGGCGTTCCACCACGCAGCCGAc
ttgatctgctgcagcagctccccGAGCGCGCGGATAGCTGCTCCGCCAGTAATTTGTCGCTTAGCAGGGCCTTCCACAACATCGTCCGACACCTCATTGT
CGTTTTGGCCGCTCACAACTTCGTTGGCAGCCACGGACCAGTCGTTGTACGCGTGGTTGCCCACGAAGTCCAGCAAGCAGCGACCAATGAGCAAGAACTG
CGGGTACTCACAGATGGAGAACGGACTTTCGCcgtccacctgcagcgccacaaGCGCATCACTGTGcgacttcttgtcgttgctgtcggtCGAGCAAGTA
GCGAGGCGCGTGGCCAGATCGAGCACATCACGgagcgtctccttctcgaacgCCGGTCCCGTGTAGTTGGCCTGCACATACATGTCGAAGAAGGCAATGC
CAACAAACAGGATCTCATATGCGGCCACGAGGCGGCTCTCTCCGCTGTCGCATTGGTCCAGCAAGTATCCCTGCAGTGCCGACGCGATGCTGCCGCAAAT
GTGcacgtcctcgtcttcgttaTCCTGTTCTTCGCCACGCAATTGATCCACAGCCTGCAGCATCGTCTGCGCTTGTGGCAGTCGAATCACACCCGCGTAC
TCGCCCTCGCAGATGAGTTTCGCCATTGCCAGCACCCGCGCCatatcgtcgtcatccttgAGCGTTTGCTGGGCCTCAATAACGCTCTTGGTGTCGCTCT
CCAGCACCGCGCGCTCCACTGCTAGCAGCCGCTGCTCCAGAAATTCCAGCGCAGCATCCTGCGTGCTGTCGATGGCTGAAAGGCTCACGCCGCACAGCTC
CTGCATCAGGTCGTCCGCGTCCGCCATTGAAAGTGATGTGCTCCAGTGGCTCCGGGCGTTGATTGTGACCGATACGTCATCTGAAATACCGGTAATTGTG
ATTAGTCATCGAAAAAAGTACCGGTTGAACAGGCGTTATGTTTTGACTGGTGGCACAGTTTTCCGTCGTCCTATAAGCACATTTTGGAAGCCGCTGCAGG
AAGCCATGGCGGACGGGGAGCAGGACCAGTTGACGGACATGACGCCGGCGCAGAAGAAACTGTTCGAGTTGCGCATGAAGATGAACGCAGGACGGAAGGC
TAACAAGCAGGTGCGACAACGTGGCGGGGGCAGGAACTGTGGCAAGCGGACTGACACGGACTGGGGATGCGTTGTCGTGTTTTGTAGGAAGTGGCGGCGG
AACACGACCGTGTAAAGAATAACGAcaacaaggccaagaaggaggagcgGTACAAGAAGAGAGaggttggtgctggtgctaaTACAGGCGACGAGTGGTA
GCGATTCTGTAAGCAACGAGAGGCGTGGATTTTTACAGGGCTGTGCTGGTGTGaaacaggagaagaagctggttgcagcaagtggcaAGGCCCATCTTAA
CGAGACAGGTTCGTGATATGTTCTTTTTGAGTGTGTTGATGTGAGAGCGGGTGCTTGATGCCGACCTGTGTGATTTGTGTGCTTGTCAAAACTATTTATT
AGCTGACGTCGCTGAAATCAAAGGCAAGAAAgccagcaagaaggagaagcggaAAGCTGCGTTCGGGTGGGACGTTTTCAACCAAGACTCGTTGTACAAG
GGCTACAAGAAGCGGCTAGTAAGCCTGCCCACGTCAGGAGAAACCGCTCCTGCCGTAGCTGCTACAGGTGAGGATGCGCTtggcgacgagctggccTACG
GCAAGGACGACAAAGTGGAAGAGGTGCGTGCTAAGACTGACGCAGTGACGCGTGCGGGTGGGTGGTGTTTTTGCAGTATCAGCATTCGCTAACGATTTGT
GTGCGCTTCGTGATAACGCAGGCAACCGTGGAGCGGATGgcgcaggagctcgaggagcgCATCAAGGCGCGCAAGAAATTCAGCCGCCGGCGCCAGCATT
ACGAGGGCGAGGACGTCGACTACATCAACGGCCAGAACCGCATTTTCAACCGCAAGGCGTCGCAGGCCTTCGACAAGTACACAGTGGAGATCCGGCAGAA
CCTCGAGCGCGGCACCGCGCTATAGTGCTAACAGCGAGAAACCGAACGATGCATTACTATTGCTTCCACCCACGTGAATGTTTCCCCCATAACTactgta
tacatgtagtaccgGGTGATACCTTGATGCAATCTCCACGGCGCACATTTTGCTGCAGGGCGCATCAAAGCAATGGATACCGGTAAACACCTCGATGAGA
TGCGGATGCTCGGACCAAAAACGGACCACGAGCCTCAGGGCCTGACCAGGGTGGTCCGCTTTTGGTCAGTTGTCCGTTTTATGTGTCGACCACGATCTCC
GCCAGCCAATCCTCGTGCGCAGCTGCCAGACAAAACATGTTTGAGAGGGTCCTCGTGGGCCACCAACACCGACATTGTGGGCCACCGCAAGTACGTAAGC
CATGTTGTCCTTTCATTCCCGAATTCCCCGCGTGCATCACAAGCCCAGACCAAGACCACCATGGCTCCCCAGACAACCCCCGCTGCCGGCTCGGCCCCCA
CCAAAGGCACCTTCCTCGTGAAGGCTGGCCTggccaagatgctcaagGGCGGCGTCATCATGGACGTGACCAACGCCGAGCAGGCGCGCATCGCGGAGGA
GGCTGGTGCCGTGGCCGTCATGGCCCTCGAGCGCATCCCCGCCGACATCCGCGTGGACGGCGGCGTGGCTCGCATGAGCGACCCGGAGATGATCGatgcc
atcaagaaggccgTGACGATCCCCGTGATGGCCAAGGCCCGCATCGGCCACTTCGTTGAGGCCCAGATCCTCGAGGCCACCGAGATTGACTACATCGACG
AGAGCGAAGTGCTGACCATGGCCGACGAGGAGAACCACATCAACAAGCACAACTTCAAGGTGCCGTTCGTGTGCGGCTGTCGCAACCTGGGCGAGGCCCT
GCGTCGTATTGCCGAGGGTGCTGCCATGCTGCGCACCAAGGGCGAGGCCGGCACTGGCAACATCGTCGAGGCTGTGCGCCACGCTCGCTCGGTGCAGCGT
GAGATCCGCCGCCTTAAGTCcatggacgaggacgagctgttcGTGGCTGCCAAGGAGATGCAGGCCCCGTacgagctggtgaagcaggTTGCCGCCACGG
GCAAGCTGCCGGTCGTGAACTTCGCTGCCGGTGGTGTCGCTACCCCCGCTGACGCTGCTCTCATGATGCAGCTTGGCATGGACGGTGTGTTCGTCGGCTC
GGGCATCTTCAAGAGCGGCGACCCGGCCAAGCGCGCTCGCGCTATGGTGCAGGCCGTGACCCACTTCAAAGACCCCAAGATCCTCAAGGAGATCTCCACC
AACCTGGGTGAGGCTATGGTTGGCGTGCAGGACCTGAAGGCTGCGGCTGTCAACTTCCGTGACCGTGAGGGCGAGCTCCACGGCGCCTGGTAATTGCGCT
CTGGGACTTGCACTATCCTACGGTTGAAtctcgctgcagcacatGTGCGCAGGAGAATCGGGCCCGAGTAGAATACTGCAAGCATACCGCTTCACACTGT
CAATATATTGTTATTGCTCAAGCTTATTTCTCGCTGTAGTGTGTTTGGTACATTTTGCGTGCTACACGTCGGCTGGCGCTGTGCAGCAAAACTATCTGCA
CACATTAACCTCGAAAGGCTCACCAGCATGCTTGATCGTACTCTTGATGGCTTGGTACGTCATGAGTACAGCTCCGATGCAGATTGTCGCGCCGATGCAG
AGCACGATCACGGACTGCCGCCCAGTCCTGCGCACGAAACCTAAGATGACCACCTGTGAGACTGCGGTGACCACGAATGCGAGTgcggacagcagcaaag
ccCAATCCCACGCAATCATGTTGAACACGGCAAACTTTGccgtggctgcagctgaagaatACAGCACCATGAGTGCAGTGGTGGCCGATGCAACCTCAGG
GACGATACCCATCTCGATCATGAGAGGACCAGTCACGATTCCTCCGCCGACCCCAAACAGACCAGCTATGAGACCGGCACCAGCACAGGCCAACGGGAAG
CGGACGACCGTCTCCTTAGTCCAGTGGATATCACCCGCTGCAAACACGTAGTTGACCGAAATCTTACAGCAGTGCTGTTTGAAGAGGTATATGGCTGTGC
AGACGCCGAAGCCAGCTATCCACGGGACCTCCAgggccagcagcaaccaataaccaccaccaccacaggtcacggcagcaccaccgatACTTGCAGCCAC
AATACCTAAGTAGCAGAGCATGATGACTCCTTGCTTCGGCAGCGAGAAATGGCGCTCGCGTTCCAAGATCTCGGCCAGCACTACATCGTCCGTCCCCATA
CCGGGACCATCACACACGTTCGACAAGCTTCCTGATCCTTTCAGTAGAGAATTGCTGGCAGAGTCTCCATCCACGTCGTCGGTTTGCTTATCCTCGACGT
ACGAGCTTGGCGAGCAGACAGCCACGtaggcagcagctcgttgctCTTCCgttgcttcagctgctggcgccgGGACAACTTCCTGCACCTTGCATTTTTT
CATCTCGGCACGATACATCTTGATTCCTTTCGACATTGCACGCGTACCGCCCACGACAAGCACCACGACAAAGAGTAGTGAAAGCAAATAACTaggcagc
aacttggcgAACACAGTGCCCACCACAGCACCACCCATAACCAACGGGATCATGGCCAACGCCAAGTCTGAGTCGATGAGTGGGCGATCCACTGCCGGGT
GACGCTTGCGGATATTGAACCAAGCGTTGGCGACAGCTCCGCCGACGATGGCCAGATTGGACACGGGTGTTGCACGCTTAATGTCGAAGCCCATAACGAG
GATCATCGCCGGCACCAAGATGGTTCCTCCACCCACACCGCCTGCTGCGGAGACTGCGAGGCCAACAGCGATGAAGACCAACGCTAGCGCGTCGTAGGTG
TCGAATGTCGACAAACTGCGCAGTTCAGGGACTCCATCATTAGAacttttgttgttgttatcATCTGCCGCGATTGTCAATGCGAGTACGGAGATCAGCA
GAGCCGTCAAGGTCAAAGTCGATGAAGGGTGTTTGCCCATGAGATGTCCTGCAAACGGGGTTTCAAGTCTGCAGGTTGGGGATCGTTAAGAAGTGCCTCG
CCCATTATAAGACGAGGAACGTGCCAGTCGTTTTTAGCTTAGCATGTCTCGGCGCTGAACGTTTTCCGCCGATGGAGGATTTCAACTCTACGGTTGAAGT
GCGGCGAGTCGCGCGTCGATATGGCTTccatcaacttcaagttgttgtcaACTTGTAGTGCAAGTCTTACCGTGGTTTGGACATGACCCGAGCTAGTACT
GATTGGGCTGATTTCATTGTCTTTGCTAACACCAAACTTCTACCGATAGATTGCTTCTTCTAGCTGCAAATATCCGCGGAGAAGGGATCACCAGCAACGT
CGATAGTGGATTTAATGGCCTGGTACGTCATGAGCACGCCCCCGATGAGCACCGCGGTAGCGATGCACAGCACGATAATCGATTGGCGACCCGTCCTTCG
AACGAAGCCCAAGATCACCACTTGCGAAACAGAAGTCACGACGAACGCCACtgcgcacagcagcaatgcccAGTCCCACGCGATCATCTTGAATACAGCA
AATTTTGCTGTGGCGGCGGCCGATGAATACAGAATCAtcagcgccgtcgtggaggaagCCACCTCCGGCACGATACCCAGCTCGATCATGATGGGACCAC
TGATAATGCCTCCACCAACACCGAACATGCCCGCGACGAGACCGGCAACTGCGCAGCCCAGAGGGAAGAACACCAcggtcttcttcgtccagcggATATC
TCCTTCTACATACTGGTAGTTCGCCGCAGACTTGCGCAGGTACACCTTGTGCAAATAGTGTGACGTAAgcacgacgaagacagcaACCCACGGAATCTCG
ATCAGCAGGAGCACCCAGTACGCAACGCCCCCGCAGTCCACGGACGCATCGCCGATGCTGGTAGCCACAACACCGAGGTAGCAAATCATGATGGCGATAT
GAGGACCCCAGGCAAAGTGTTGTTCCTTCTCGAGGATCTGGGCTAGTGTTCCAGCTGATCCTGCTTCGTCCCCAGTGGAAGCTGAAGTACTTAAGCGCTT
TTCTGCTGAAACATCATCTTTACCGGTGGTCAACGGCGTGCTGGCCTGGACGTACACGCTGGGGCTGGCCGGGACATCAGCAGCGACCTCGTTTGCAGCC
ATCTCAGCTTCTTTCATCTTAGCGAGCTCTTTCTTGTGCAGGCGGATGCCCTTCATCATCGTGCGTGAACCACCAACAGCGAGTACCACGACAAATAGCA
ACGACAGAACGTAGCTCGGAATAAGTTTGTTGATCACTGCACCCAGCACCGTACCACCGATCACAACGGGGATCATccccagcgccagctccgggTCGAT
TAATGGGCGGTCGACGGTCGGGTGCCGCTTGCGCATGTTAAACCAAGCGTTCGCCACAGCGCCGCCCAGGATGGCTACGTTGGAGATGGGGGTCGCGCGC
TTGATATCGAAGCTCATGATGAGCACCATAGCCGGCACCATGATGACGCCACCGCCCACGCCGCCCGCGGAAGACACAGCCAGTCCGACCACCATGAACG
CGATGGCTAGCGCGTCGTAGGTGTCCATCACGGACAGACTCGGcacgccatcgtcgtcgtcttcgctgttgctgctgccgtcagCAAACGCTGTTGGGAG
CACCGCCGCAAGCGCTACGAGCACGAGGAGGGAGAGTGCGACATGACGACAGCGCGGACGGATGGTCGAGATGCCCATGTTGCGACTGGCGCTGCAAATT
CCGAAATGaaagtgtgtgtgtgcgttGGCGAAGAAACTCTTACGCGGCAACTTTTCTATTTTAAAATAGAATATCCTGTAGCAATATATTCTAAGTTCTG
GCAAATCAAATGTTTTGTGACCCCATTTAACAAATATACTTGTGGGAATGAATGGATAAAGTTTACGCGTGGAATTTAGTTTGTAAATCTGAACCGACCA
ACACTCACTAATGGACATAAATCGCGCTGAAGTGCGGGACGGGAGATGAACCGATTGTTGTACGTTGTGCCAACAAAACATGGTTCTATTCAGAAAATCT
TTCCCAAAGAACGGTACAATCTTGCCATTTCTCCTACAAAAACAATTAGCAAGATCAAAACACTACCTTAAAGTGGCACGAATTCTGCCAATTGTTATGT
CTTCGTGCAGTCGACCCAAGCGTGACGTGGGCGCGTTACCGGACCCTAGTCGGCCAGCGGCAACCAATGGAGGCCCCAGCTCGCATGACGATGGTCTCCA
GATATGTAACCCACAGCTGTTGCTTCTTCAAAGATCGTGTTCGTCGTATCAACCGCCAGCCAAAACTGGACGGAGGCACAACCGTGATCGCTGCACACAC
TACTTGCAGTGGTAGAAGTCCGCAGTCAAACGTGTGAAATCGTGATAACTCGTCACCTTCACTCACACCACAGAGTGGTggctcacttcaacttgaacat
GACATATCATGTCAGTCGGGCGGGTCGCCTGGCTCAGCATTGGTGATCGCTAGTTACGGATGGTCACAGAGCGTTGAGTCTGTAATACAGCGAGCATGGC
GTGCACTCGAAGCGCAGGAACCGCATATTCATTCTTTGTAGAGATGTAAAATTGGGCACTTGGCATAAATGTCTGCATGGGGCCCTGCACGAGTACCAAC
GCGCACGTTAATTAAAAACACTGTTGCACGAGCACTCAGCAATACTGGTGCGTGACTGATCGGTGGTTGCGTGCTGATGGAGCTTTTAGACTGGGCAGGA
ATCGTGCTGTGGAGCACCATCGACTGTACCGACTTGCGACATCCAGCGCGAGGTCGACAAGCATCGTCCAGCAAGCCTTGCACTGCAaacgcacacacac
accccGCCTCATTGATGATGTGACGCAAATAATCGACTGCCGCCCGCCAGCGCTTCCTCCGTTCCCGGTTTGTGACCTCCAAGACAAGCAGGAATGGGCA
TCCGATCCGCACCAGATCGACCGCACTTTTGCCACGCAGTACTCCCAATATGACGCTCGC