Description :
From Genome Similarity Track
Location :
Scaffold_95:13946- 19794
Sequence
5848 bases(100 bases per row)
CACATCGTCCGACGTCGAAGACGTCACAGACGCCCTGCGTCTTCTTCTCCTCTCCCTCCGCGACCGAGCCCGGCCGGATGAGGGCGGTGTGGCGACATCT
CCATCACCACCACCGGGTGCAGCAGCACCATCACTCCTCGAAGAGGATACAGTGTCTCGCAAGACACTCGGCTGAAAGCCAAGAGGTTCTTGACCTTCAC
ACAGTGAACTAGGTGTCACTTCACCTGCATCTCCTGGGCCACGCCCATGATGCCTCGACGCGCAGTCGACCGCGACCCTCGGGTCACGCAGCGGTAGGTC
ATCGACCAGATTCGTACCACTCAGTAGGTTACGCGCCACTCCGCGCTCGTCCTCACCAGGACCCAGCAGTTGGTCATTGACCTGACCTGCACCGCTCAGC
GGATAACGTGCCGCACCACCTACGCCCTCAGGGCAAACAGCAACCTCGTTGCTAACAATTTCGGACATACCAATGTCTAGCACTACGGCCGCCTCGGCCT
CGTGCTCGCGCCAAAAGCGCTTCTGCTTCCTAGCAGAGGTGAATTCATGACTCGCCAAAGCTCCACTAGGAGCAGGGTGCGACGCACCCAGCGTTTTCGA
CTTCCAGTCGATCCATGGCTCATGGCGTTCCAGCCATGCCATGCCAAGGATGAGGTCATACCTCGCATCCAGGTCTAAGACCAAACAGCGTTCCACGCTA
TCAAAGTTCTCAAACTTCACTCCAAGGTCGACAGAGACCTTCGACACAGTTACCAGTGTCCCCGTCGCGAGACGGACAGAGATCGTATCTCTCGTTGGCA
CTACCAGTGCCTCAGCATACAGCTGACTCCCTTCCAGGGTGGAGCGACGGGCGTAGTTGCCCGAGGCTCCCGAGTCAATCAAGACTCTCCATGGCTTTGC
AAAGCCCTTCACGTTCGCTTGAACGACCAGCAAGCATCGGCGGATGCCGGCGCGCTGCTCCGCAGCAAGAAGCTCCGCTTCTTCATCTTCAGCATAGCTG
AGGTCCATCGGCTCTGGACCGCTCGAAGAGCTTGCGCTACCAGCGCTCCAACCAGGTCGTGCCGACCTGAAGTTGTGCTCGGCATTCAATGCCACATCCA
CCGCCTCTTCAAAAGAGTTAGGGTGTACACGGAATACTTCCGTTCGAGCTGCGCTCACACGAAGTCCCTCCATGAACACGGTCACGCTGACCAGTTCCGG
AAGAGGGTCCGCCGCCATTCCGGCGATAAGAGTTTACAACTCTTGGACATAGTCCAATAAATCCTTCTTACCCTGGCGGGTAGCAAGGAACTTTGACCGG
ATACGGTACGCCTGATTAGGCGGCGCGAACACGCGCGAAAGCTGTTGCATCAGCTGATCCCAAGTGGGAAATGCAGCGTTAACAGACGTGCCGCACGTTA
GTGCTTATTCGCGAGCGCGACCTCCAAGCCTGGAGATAGCCAGTGCCACGCGCTGATGCTCAGACTGGAGCAGGGCCGATCCCATGGCCATCTTGACCTC
ACGGGTCCAGAGAAGGAGATTCTCTCCATCCTTCCCCTCGAAGGTTTTTACGCTCACCATGAGCGGTTTCAGTCTCATAGACTCTTCACGCGTCATCGAC
GCCGCCGCCGTTGCGGCGCTCATCTTCTCTTGGACATGCTCCAAGAGCGCGTTCTCGTAGCGGGAGAACGATTCCAGCCTGGCAGTGACCGCCTCTGGAC
CTTGCGATGCAAGATGAGCCACGCCCTCCGGGCCAAGCAAGGACATAAGCTTAGTAAGCGCGTCCTGCTGCGCCGGGGGCAAATTCGCGAACACGGGGTG
TTCCATCCTCGCAGAGGATATAGTCAACCGACTCAGGAGCGGGATTGACTACAAGTGCTACCAAGTGCAGCGGGGCTGCCGTAGCTTTAGCGTCAGAGGA
AGACGTTCGACTCAAAGAGTCACTAATACTAAGTTCCTTATCCAAAGGACACTTACAGCCCAAGACCAGGGCTCAAAGTTAACACCTTAACTTTTATGCT
TCAAAACCAGAAGTGATTTATTTACTATTATTGCGGCCAAGCCGCCTAGGGGTAAATGTATCTCTTTAACTATCTAGCATAGTTAAACCTAATCAAATGC
ATAACGTGTGGCTTTCAGCCAACGTACTGAGAGACCTTCTTAACTCTCCAACTTATGTACTGAGTGTTTGTTAACTATCCGGTACGAAGTACCCTTGTGT
GCTCCACACCATGTAACCCCGCTACAAAAGGCGTGCTTAATCGCAAATTGACAAGTTCACTTACCCGAATTGATGTCAATCCATCACCCTGTAAAGGCAT
ACCAAGCGTTTCACATTGCAGCAGACAATTTGCTCAGCCGGGCTGTAACGGATAAGTCCTTAACGTTGCGTCGGCGAATCGCATCCTGTACACGCGGACA
CGGCTTGCTGGTAACACGGACTGTATCCGAAGCGTCGGCCTCAGTCGCGGTAGCTAGCAAAAATGCGATACCGTCCGGAGACCGGGAGTGTAGCTCAAGC
AAGCCCGCTCGCGACATCGCCCGAGCTCGACGAACCAACCGAGAATATGGCGCAGGGGACACGGCAAATGGCCAGGCGGTGGCAGCTTCACTTTGACACA
GAGCGTAAGTAGCTGGGACAGTAGGGCGCCGACCTTCTGCTATCTTCGGAGCGTGACATCGCTTTTGATCGCTGCATTGTACGTCTCGCATGGCTTGTTC
GCTGTCGCAAAATCACTCGGTGTATGAAGCATTGCCAACGTCACACCCTCTTAGACCGACGTTACATCTGCACAAGCCTTGCACGGGGCCAGCTCACTCT
TCACCACCCTAGTCTGCTTAAAACCATCCAGAAGGTTCACTGTCTAGATGCATGGCATTGCTGAGACGATAAGCAGTCAGGGGTGTCGAATGGTCATTTC
AAAAGGGAGGAGCTGGGAGAATGAGCTTCATGTGGCTGATTGGAATATGATTTTGCCCCCCATCTCGCTGGGAAAATGCGCTGGTTGGATGATATTTCGG
TGACGATCAGGTTGCCGATTGGGCAATTAGCGAGTGAATTACGGTTGGTGCAGAACGTACTATTGCGGTGGTCAGTCTTGAGAAGTTGGTGATGCTAGCG
ATATGACTGTGCTAGCCGTGCTTTGATAGTACATTTTTGGTGTTTCACGCGCGCCAATGCGAAGAAGCGCGTCCTTGACGCATATAGGCAGGCCAAAACT
GGCTGGGTGTGGCTGTATCTAACGCTGTGTAGTTTTCATTACTGCCCGCCGCATTGTTGCAAAGAGCAATATTGAGCAACGGCCTAGCGTGCTCCGTCTA
AGGGCAAAAACTTACAGGTGCAGTGCGGCGTGTCCCTCGATCAAGAGCTGGTACTACTGCGCACGCACGATGGCTCCGTGCGCAAGGAGGAGAACGCAAC
GTTTGCATCGGACCTGTTCGCTGCATCCGTCAACACCGACGAATGCAACGAGTGCTGTGTGAGCAAGAAGGCTGTTATCGTTGCCGACAATGGCGCGAGT
TTCTTGAGCGGGGTGATTACGATTCGCTGGTCGAGCACAGAATGTCGCTTATCAAGGAAGCGGTAAGTTCAGCAGACACAATGTAGCACAGCGCTTGGTC
TGGCGCATGGAACGCTATTATTCTAAAAGTATTTTCCTTGCGACGGAAGAGATGATATGATGCCATAGATGCGCTAACTAAGCAAAAATCGAGCGGACAA
CTGTGAACGAACAAGGTTACAGCGTGACCGTAGTTTACGCCGTAGCTCGCGGTCGTTATAGTTTGTGGGAGAACTGAAATAAAGATTTTTTAAAGATTGG
AAAATATGTAGGCCTTAAGCATCGTATAGGTCATATCTTACGTCGATATGTGCTTACAATGGTCGCAATTCTAGTGACAGAGATCCCACCAAAGTTCCTG
AATATAGGATCGACGAACAGAACGCGAGGTCAGCCAGGCCACCGCAGACGGTTAGCACTAATCCGATTTATAGTATCGTCAGCTTACAATCAAACGTCAA
GAACGGTCCAAGTCCATGCGGGGATACACTGCAAAAACATATTTAGAACTTGTTTAGAAATGTGTACAAGCGAGGTAAACAATTAGCTCGCCTAAATTTG
AAACCTAACCCTACGGGTCAAGTATATACGCTCAAAATAGTCCTACTCCGGACTATATATTTCTTCGCAGCGCTGCTAATAGTACACTACTGTTTCTGCG
AGACTTACAATTTTTGTAAACCGCGCTTGGCAGAGCCAATTAGCTCGATACCGCGGTCTGGAACTGTCGGAGATCTTACTAGTGTTGTCAATTAAGATTA
AATCTATACGACCGCTGTCAAATTTCCAAAAACAAAACCACTTAAAGGAAATTTAAGGTGTTTAAGAAAAATAGTAGTAGCTCGAGTGGCGTACCACCAG
TATGGAGTAAAATCTGCGTTACCAATCTGTACCGGAACAGTTCGTATGTTCATTTTTTAGATTGTTTCACAGCTATATGCAGATTATTGTACTGGTTTCA
CTATTGGTATATACCGCAGATCGCGCATGAGCAGGTAGAAACGAAGACGTGGCAGCAGAGCACTGAATTCTTCGAAAACGTCTACCCTCCCGCCCCAGCT
TAGCTTTTGACATGTGTCGTATCTTAAATGTGTAGTCTCCGCCAGCAACTACACAGTCGCTCATAACGCATTGCAATGACAGGAACCCTGCATTTATAGA
CGCTGGTAGCAGCTCATAGGAACTAAGATGCACCGACTCTTGACCTTTCCCAGAATAGAGCAGTTTTTCATCGACATAAGCTAAATTGTCCATGGCATCA
AAGAGATCGGTTTCTGCACTGATGCACTCCAAACTAAATGCAACTCTGCGCTTCTAATTTCTTCAGACCCATATGTTAAGTCACAGAAGTCTTGACACGG
ACACTCCCGATACTCATCACTCAAAAAATCATCGGAGGAGGAAACAGGCCTGCGCCGCGGCTCGAACAGCGATGTGCTCGATTGAGTCTACAACTCGCAG
TAGTTCTAGGGCGGGGGTTCGAAATCTCCTTGGGCGATCGGTGCAGTGCAACAGCGACGGCAACGCGTACACGCTGGTATGATCATAGTTGGCGAGTGTG
CGTTCGAGTTCTCACCCCGAACGATCCAACTCTGACGAGTACACATCGGCGAAGAATGCCACCGACCGTTTAGTTGAGGAGTGCGGAAACGTAAATGCTC
AGCCTCGGATACATGATCTATTTTATCATTTTCAGACTTCGGGTCGTCAAATATTGCCCAATAATCACCCGTATAAAAGTGTGTAGTGGTTGAAAGTAAA
TTAAGCTCTATGTCAAACTATGCCCACCCCGCGACATTTGAGTCCATCATCAGCGGGAAACGGCATCTTTATTGCTGCCCCGGTAAGCCTACTGACCAAA
AATATTTCGTCCACTTACATATAAAATTCGGTACGCATGACTTGTAATATGTAAATATTGGTCATGGATTGGCTTGGAGCTGAGGTGACGCTGGGCTCGT
CCGGTGTACTGGATTGCTCTCTAACTGTAGGCTGCTTCTGAGCGTGGGGCTTACACTAAAGAAGCACTAGCAACAAAAGAGGTCTGTAAACAGAGTGAGT
GTCGAGCAAAAGGCCACGACAGGAATGCAGTTCTAAAATAAGGCTTGCTCGTATCTAGGGTTTGCTGAACCGTATATTTAAATGTCCGTGAAGGATCCAG
CTTCACGCAAGCCAGTGCACCGCTCCGCAAAGTTCTATTCTATACATTAAGTAGTACGAAGCACACTTCACCTAAGTCAGCGGGTCGTGAGCAGCACGAC
GACACGGTCGCTTTTGCCAAGCGATCTTAGTAATCTGGGAATCGCTTT