Description :
From Genome Similarity Track
Location :
Scaffold_319:13946- 17078
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_319-snap-gene-0.9Spindle assembly associated Sfi1 homolog
Pytul_var.sporangiiferumsnap-pug3_contig_319-abinit-gene-0.36Cryptic tubulin

Sequence
3132 bases(100 bases per row)
TGAAAATGATATCTTGAGAAAGCGACAAGTGTTCACCGCATGGGCTGAGCATTTGCGGAAGCGCCAGACAAGTCGTCTTGTTAATGCCCACGCCCGTGGC
CATTGGCAAGTGAATGTATTGCAAAAGAGCTTTTCTCAGTGGGTTGCAAAGATCGCAGATTTTCAGTGGCGTCAAATCCAAAACCAGCGCGCGCAGAAAC
GATATGCATCGACGTTGAAAGAAAAATGTTTTCAGTTCTGGAAACGAAAAGTTGAGGCGCGAAAGCAATATCGAGAGCAGAATCGCAAGGCTTTGATTCA
TTGGAAGCTTGCAGTGGAGCGTAGGTTTTTTCCAATGTTGAAGCAGTATGCTGAGAGCAAGAAAGCCCAACGAGCAAGAATGCGTGATGCCCTGGAATTT
CGTCATAAGCTCATTGTGAGCGATGGCGTCCGGCATTGGATGACTGCGTCTCTGCACTTGCAGGGGCAACGCGAGAAGAAAATTAGCCAGTCCCAAGCAC
TTCATACAGCTCAAATCTGGCGCACAGTTACTCGAATTGCCCGTCATTGGAGGTTGCTGACAGTGAAAAATCGTCAATCGCGCGACAAGAGTAAGCTTGT
TGGTGCTGCTTTCCGGATTCAAGATACTTGCTTAACTGAAAACTTTCGCATGCGACGCATCCAGAATCGTGTGCCACCAGTGTCTCTCCAAGCCGAGAAG
GAACGACTGGGATCGCTCCAACCGAGAGCAGCGATTGAAAACACAAGCACGCGATCCCCTCTATCTGAATTTGTAATGGTGCCGACGAATCGGCCCCAGC
CCCGCCGACCGTTTGATCTCCTGGTCGAAAATCCTGAAGTGAACAGACTGCGATTATCCGCAGTTAGAGCGGCAATGGAGCGCAACGTGAACGATACTGT
GTATTCAAAATATGGATTCAACTTCCCTGCCCAACCTTTTGAACCTCTCGGTGTCAACATGATCGATATATCTGGCAGCGTCTGCCAGCATGAGAAATCT
GTGCTGCCACCGAGCACCCAGACCAAGGAGACGCAAGAGGTACCCACTGCAATTGCTCCTCCACAAATTCATCCGAAGTCTCCGCTATCGCAACTGGACG
CATTGGAAGCTCAATTGCTGGTCTGGAAAACCAAGAGACAAGAATTTCGAGCATTTCAGAGCAAACTGGAGAATCATCGACGTTGCATACAGGATCCGTC
ATTGCAAGAGTAAGTCTGCATTCCACTTTCTGTCCTCTTTTTAGCTAATTCTGTTGCTACCAGTTCAATATGATCTAACAATTCTTGTACCGCAGGAACA
CAAACCCAGCTGTGCGACGTCAAATGCAGATCGAATTGGAGCTCATGGAGAAGCAAAATGAAGAGTTTTGCAGAAAGTGGGCGGCATCGAAAGGGCGAAT
TCGAGCACTACACCAAGAAATCCAACGCCTCTATGCAACGTTGCGGAATGGGTGATATCAATTCCTTTCATCGAAGGAGATCTTTGTATTCAGCTATAAG
CTGCCGGGATTTTTCGAAGACGTCCTGAAAATGGGCTTCTTCTAGTCCGTGTTGCATGTACCAGTGAACGTACGCACGCGCCTTGAATTGGCGCTCAGCG
CGTTGCAGGTACTGCTCGGCGCTTGTTAGCACATGCCCATTGTTCACACATAATGTGATCGATGCCTTGCCCCCGTTTGATGGAAATGGAGTTGAGGGTG
AATGCGAGACAGCAATATGATAGTCTGAATTCCACGATACACCAGGAAAAGCTGACGCTACTGCTGCTTGAAGCTTCGTTGACCTATTGCAGTCGTTTGG
ACTCGGAAACCCGCGAATGATCGCACTGCTAGAGAGGGTGTGTGACGCTGAGCGAGGGAAGGATTGTGCAGTTTGGCGCACCAGTTTGTTCAAGATTGAC
TCGATTTCATCATCACTTCCCGAACGAAGCGTGAGTGGGTGCTGGCAAATGCCTGCATGGAACAGCGTCGGGTCGCTTTTGCTGGCTTTCGTCGAGGCAG
AACGTGACGATGACGATTTCCCTGTGAGCACACCGGTTCGGACGTCGAGGAACTTGGCCGAGTGCAACGGACAGAGATCATGGATGAGCTTCCCGAAGTC
GAATGGTCGCGCACTAGCAGCACGTGATGGTGCGATTTTAGACTCCGGCACAAGTGGAAAAAGGAGCCCAGCGAGATCCGCTGCTGCCAAGTGGTTCATC
TCGTCGATCGATACCCTGTACGACGGCAGACCGCTTGATGCGAGGTTGCCGATGAGGTTGTCCTGCTGACTTTGCTCTTGAGTCTGGGCTCGCAATAATG
CCTTCCAGTATCCGGAAGTACGCAGCAATTCGTCGTTTTCCTTGTAGATGATGCAGTCGGCATGCTCTTGAAGATGCGCGAGTGTAAACACCGAGTTGTA
ATTCTGCAGTGGCGTGTCGCCGCATTTCCACGACGGTGCGACGGATGCTGCCACCAAGTACGCTTTTGGATACGTATCCCGTATGAGCTCCATCAATCGG
CATCCGAGTCCCGAACCAGTGCCGCCACCAAGCGAGTGCATCAGTACGGTGCCCTGGTAGCAATCGGTTGACTCGATCAGCTTCCGTAGCGAGTCCATGG
TGAGGTCCACCAATTCGCGCTTGTCCTCATCAAATGGCGTGAATTTGACCACCGGACGCTGTCGAGACTTTGATGAAGCAATAGTGGTATGCGCTTGTGC
CATTGCCGTCTTTGAAGGGATCACATTGCGCCGGAACCGCTGGAAATTGTACCCCATCGCCCAATTGTTCCCGCGTCCAGACTGCTCGAAATGTACAAAT
GCAGGCTCATGATGTCGTGGCCATACACGACAGACGCTGTGCACATCGTCGCTCTCAAGCATCGACCGGATCACTTTGGGCTCGGTATCCACCAGGACAC
ATCGCGCTTTCCTGGACGGGCGAAGAAAGAAATGCTCGTAGTACAATGACGGTGTCGCTGGCGATGACGCATACACGGCCCGCAATGGGGGTGAGGCCTT
CCGGGGTTTTGCGAGTGGTGCACTGAGCCCCTTCCTGTCTTCGCTATCGTGGTCGTCGTCGCTGCCCACGAGCTGCCAGTACGCCGCGCCGAGTTGGTTG
CCGCATTGCCCGACGTGCACAAACGCGCTCAT