Description :
From Genome Similarity Track
Location :
contig_30:139454- 141401
Transcript NameFunction/comments
g5294.t1hypothetical protein
g5295.t1hypothetical protein PHYSODRAFT_307593

Sequence
1947 bases(100 bases per row)
CAGCATTTTCCTGTGATTGCGATCGCCCCACAAAAAGTATCTGACTACTCTTTTATCCACCAATCACGTCCATACCCTTTACAAACCGATATCATGTATT
TTGAAAGGTAACATGAGTGAATGCGAATCGACAGTCGCGTGATTTTAGGAACGAGCCATCAGTGCAAATTGCAAAGCACTTCTCAATTTGCGCAACACTG
GATAAGATTCTCTCCATGACTGCAGCTTCTCCGACGCCTCTGCTGCTGGACGGCAAGGCCACGAGCGACGTGGTCCGTACGCAGCAGCTCAAGCCGCAGT
GCGAGGCGTTCCAGAAGAGCCACGGCCGCCCTGTGGGCCTCGCCGTGGTGGTTGTGGGCGCCCGCAAGGACTCGGCCACATACGTGCGCATGAAGCAGAA
GGCGTGCAGCGCCGCGGGCATCGCGTCCTGGAAGATGCGGATCTCACTAGAGCAGGACGGTAACGAGAAGCCCGCGGAGAAGGTGACGGCGGAGCTGCTG
GCGACCATCCAGACGCTCAACGAGCGCGCGGACGTCGACGGCGTCATCGTGCAGTTGCCGCTGCCCTCGTTCTGCGACGAGGACGCCATCCTGGCCACCA
TTGACCCCACGAAGGACGTGGATGGACTGCACCCGGACAGTCACGCGGCGCTCTTCCAGTTCGCCACCAAGAAGACCTCGTCTCAGCACGACGAGGCGCC
GTTCAGTTTGCCCTGCACGCCTGCGGGTTGCATGGAGCTGCTGGACCATTACAACATCCCGCTGGAAGGCAAGCACGTGGTCGTGCTCGGTCGTAGCCAG
GTCGTGGGCCTGCCTGTGTCGTTGCTGTGTCTGCACCGCAACGCCACGGTCACCATGTGCCACTCGCGTACGCAGGACCTGAAGGCGCGTGTGCTTGAGG
CCGACATTGTCATTGCGGCTATTGGACGACCGCGCTTCGTGCAAGGCGACTGGATCAAACGCGGCGCCACGGTGATCGATGTGGGCATTAACCCCGTGGA
AGACGCCTCGAAGAAGAGTGGCTACCGTCTCGTGGGCGACGTGGACTTTGACGGTGCAGTTAAGGTCGTGCATGCCATCACTCCTGTGCCAGGCGGCGTT
GGCCCCATGACTGTGGCCATGCTCCTGAAAAACACTATCCAGTGCGCAAAACGACGCGTGCAAAAGCAGTAAAACACAGAGGATACGAGCGACGGAATCC
ATTCAACGCTTCCTAAAGTTTGGAGACTCACCCTGGCCCAGCAAGCGAACAAATCGACTTTGCCCGGCTTCGGCTGCTAATCCTAGTTGGTAAGGCGACA
ATTGTAAGTAAAGCGTTCCCTGACCCCGTTCACTGCCTGTACGGGCCCGCTAGAAATCGTCGTGATGACCGAAGAGCAAGTCCTCCTCGTCCTCTGACGA
GAACTGCCCGCTTTCTTCTACGAGCTGCACGTCTTGGTGCAGTTCCTCCCAATATCCTCCGTGTGATTGCTGAGCTAGAGGGGCTCCTGTTGCCGCTTCA
TTATCGCCGTCTGCAATCTCCAGGTTAGTGTCCTCATCGTTGTCGGCAGCTTGCTTCTCGTGGAGATGGTTCACAGCTTCCTCCAATCGTTGCAGTGCCG
TCTTCGCACTAGCAGGACGAGCTAATGCGGGTTGTTGCTGATGCTGCTCCTTCGATTCACCTGTAGATGCAGCTCCGAATCTCCGTTGGCCCTGAAGCAG
TAGTCGCATGCAATCAAGTTGACCATACGCCGCAGCGATCTGTGCCGGAGTCTCCCAATCACTGTTCACAAGTGTTGGGTCTGCACCAAGTGACAGCAAA
TTCTGTGCCACCGCTGCGCGACCAGAAAATGCTGCCCAGTGCAGTGGGGTATCACGTCTTTCGTCGGCGGCGTTCAAGTTTGCTCCGTGCTGCACTAGTC
GAGCAATGATCGAGAGAGCAGCAGGCGATTCTACCGCGTAGTGCACT