Description :
From Genome Similarity Track
Location :
Scaffold_61:13944- 15177
Transcript NameFunction/comments
g13882.t1hypothetical protein

Sequence
1233 bases(100 bases per row)
CTGGAGCTAGAAGACAATGACCAACCGCGCAGGCAAAGTGGGCAAGACGTGGTGTGAACCTCTTTGATAATTGATTCGAACTCGATGCAATGGCGAGTGC
GGTATTGTGCAACTCAATTCGCAGTCACCATACCTATTGGAAACGACTCAAGCGGACTATTTCAGCGTTTTCATCTCTGCGGCCTGAAGCGACAGATCAT
AATGGAAAACCAGAAAGCCAGGCCAAGGTTAACACTCCGAGTCTCGCTGCTGGGCCGCGCCATTCTTCCCGACAAGCATCATCATCATCTGCATGAACTG
CTCGTGTCTGCGGCGGTTCTCGGCGCGCTCTTCGGCGCGTTCTTCGTTGCGGCGGCGCCTCGCCTCGCGCTCTTCGTCGCGTCGGCGATCCTCTTCCTGT
CTCCGCTGTTCCGTCTCTTCCCGTCGGCGTTGCCGTTCCTCATCACGACGCGTTCGCTCTTCCTCGCGATCCAAGTCCCGCTGGTACTGCGAGCGGAGGA
CCACCTTAAGCACAGACGTGAGCAGGTCGTCGCTCGGAGCTGGCGTCGCCTCCGGTGGGAAAATAGCTGCCGGGTTCTGCCACTCCGGACTCTGACGCGG
CGGCGTACGCGCTCGCGCGCGTTGAGCAGGAGCAGGTGAGGCAGCCGCCGGAGCTGAACCTGGAGCTGCAATTGGCGCTGCAGCGGGAGATGAAGCTGTG
ATAGTGGGCGTGGTAGCAGCCACCTCGGATGCAGTGTCCACCCAGCTGTGTTCGGACTCGGTGGCTCCGTCCTGACCTCTCTCCTCACTCTGCGGCGGCT
GGAACGAGGTCTCATTGGGCTCCATTTGATCGCCATCGACGCTGGGCACTGCTCCAGGAGCGGGCGGGACGCCCTCGATCATCTCCTTGTGCACCACATG
GGCGAAGGTGATGGCCTGGTGGTTCTTGGCGCCGCGCGGCGGGATGCTGGACCTGTAGAGCCGCGAAAACTTTTTCTTCAGCGAGTCGGCCGAGCGGTTG
TGCTTGGAAAACTGCTGGTTGTGCAGCTGCGCGACGACGTCCCAGCCTTCGCGCCAGCGCGCGCGCACCAGCTGCAGAAGGCCCATGGACTCAGCCTCCG
TGAAGCCGTCCCCGCGGCGCTGCACGTGCAGTCCGACACGCCGCTTCACCTCGGAGCTCTCCATCGCGTCCGGCGGGGAAAAGCGCGCGGCCATTTTTTT
GAGGGGGACCAAAGAAATTTTGGGTGGATCAAA