Description :
From Genome Similarity Track
Location :
contig_69:13938- 15085
Transcript NameFunction/comments
g12161.t1hypothetical protein

Sequence
1147 bases(100 bases per row)
CGCGCCAATTGGGGTACTGGGTCGGCACCACACCAGCAGTTACAGAAAACCGGGAGATTCGAAAAGAGAAAATTCAGCGCAGAATATGGATAGCAACCAC
GATCAGCATCACGGTGGTCCAGCGTGTGGAACTGTTCAATGCAGTGGCACTACCCGCTATTTTATATACAGGAAAACAGTTTGTACCGACGAAGCAGATA
CTTCGACGACTACAAAACCTTCAGCAGTTCATATGGAAAGGACAGACGAGCACTGCAGCGATGAAGAATAAGTTTAAGTTTGCATGTATGTTTACCCCAC
GCCAACGAGGAGGACTTGAACTTCAAGACGTCAAATGGTAACCCGAAGCAACCTTGCGGAGAGGTGGCTTCAAGAAGAACCCGACCTTTATTCGGTAGCA
CGGCACTCAACAGTACATCCATACGAATCTATGAGTTCAGGATACTGCTCGTTCCAGCCAACTAGCCAAACAATGATTGAGTCAATTTTGCGAGAGAAGC
GTGCGTGAAAGCTAACGACAAATGTCCAACAATCGGGCAAATGTGAACTGTGGTGGGCACAGTCGGAGCGATTACTACCCAGTGAAAAGCAGAAACAATT
ATTTCAGCTAGAAGCTGAAAGCTCCCGGCCGTTTCTAAAGCACCGTACTTCAGCTTGCAGACTTTCTGGGGTGTTTTAAAACCATTATTGCAAAAACCGG
CGGTGACTACACGTGTTTTGTACGGATGTGTTCCAAATCGCTTCTTTCAGTCACTTGGATTTTGTAAATAGCAAGCTCGTATGGGACGATCCCTCAAATG
TGTGAATGTGGTCAAATCCCCCCCCCCTATCACTCGAAAAGTTATCCAATGGAAGCCAACCACTAGGGGTGGAACTTCACGGTAGTTTCCTGAGCAGAAG
TAAGGGTGGTAAGGCGGCCTTCTATTTTGTAACCGGGTACACCGACGTGTACCCATGTTACATAAAGAGTGACGGGATGTCTCTCTTTTGTGCCCATGGT
ACGTGGTACCGGTTGGCGGTGAGCCAACCATTGGGCACTTGTTTAGCTTTTACTATAGTTGACTTAGAGTTTGTAAGGATCAAGCTTGACTCACCTATAA
TATATATTCAGTCTTTAAACCTACCGTCTAAGTCGTAGTCGGTTCCC