Description :
From Genome Similarity Track
Location :
Scaffold_5:139376- 140405
Sequence
1029 bases(100 bases per row)
TACTGCTTCAGCCCTGAGGACCGGAAAAGGTGATGAGCTGCGACTGTCTCGCTCCGGATGGAGTCCGCCCTATGGGAAGGCAGTGTTTCGGCGATCTAGG
AGATCTTGGAGCTCGGCGATGGAATCGAATGCGACGAGCGTGCTACTGCATGCCATCTGCGGTTGAAGTGTTCGTCTAAACATTTGGGGCGCGGCATGTT
GAGACTTTTCCTTCAATCGGGATGCGCGGACTGCATTTTGAACTTCGCCACAATCACAGCGAGCTCCGCTTGGGTCCATCTGAGTGGCTCCGCTCACGAG
GCAGACGACAGCGGCACTCGAAACGCGTGGATTCACCCCCATGGCGCCCCGGTTTCGCCATCCAGAGTCGGTTTGTCCCGCCATCTTGTGCACAGCGTTG
AACAATTTTCGACGCCCCGGAGCGGATTGCAAAGACACCCCGGGGCATCCGTGCAAGGCGTCCTTCGCCGTTAAAAATTGCTGTCACTTCATTGTCGTTT
GAATTTGTCAATGAAGGGGTGCTCGAGCGGTGCGTGCATTAATTAACGCAGAGCGGCCGAAATGCAAGGGGCGATGCGAGCGCTGGTGTCGTTTCCGTGG
AGATTCGTCGACAAGCTACACCAACTTGGTGTAGGTACTGTATGTACCAAGCACCCTCGAAAGGAAAGTGACAGCTGTCGACCACCCGGAACACCAGTGC
GCGATTTCGCTGCTCTCTCGTCGCGCCTCTTGTCTTGGTGGCGTTGCAATCGAAGCCACCATTATCCACGCTAGTGATACCTCTGCGATTCATGACAATT
GCAGCGCGTTCATGCAACACCGGTAACAACGAACGTTGAGCAGCTCGGTCAGCCGGGTTAATTTACACCAATGAACGGCCAGTTCGCCCGGCTTTTCAGC
CAGTACCCACCCTTTACAAAAATGGACCGTCTCCCTCGACTTTCAGCCAATGCAATCTGATTATGCGCCCAAAAGATCGACGTGTTCAACTCGCTATCAA
CGATTGGTGAAACTTCTGACCAATAACAA