Description :
From Genome Similarity Track
Location :
Scaffold_144:13934- 15835
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_144-fgenesh-gene-0.8Carbohydrate-binding protein

Sequence
1901 bases(100 bases per row)
GCTGCTGCTGGAACGACTGCTGCTGCTGGAACGGCTGCTGCTGCTGGAACGACTGCTGCGTCTGCACACCGCCCTGCGCGGCCAGCGCCTGGTCCTTGCG
CTGCTGCGGCGTGTCGTCCTTGAAGTAGTCCTGCGCCGTCTGCTCCTCCTCGTCGAAGCGAGCCTCGCGCTGCAGCTGGTACTTCTTCCAGAACATGTAC
AGCGAGCGGATCATGAGCAGCACGAGCGCGAACAAGTTGAGGCCCACGATCGCCAGCGAGATGCCGTTCTGCAGCTCCGTCGGGAACCCGTCGCTCGTGG
CAGCGCTGATGAGGAAGAACGTGAGCACGAGCACGGCGATCTTCATGATCGACACGAAGCTCGTGGCCGTCTGCACGAACCGCGAGTGGTGCGGCGACTG
GATCTCCAGGTAGAAGAAGAAGATCACGTTGATGCCCAGCACGATCGACACCTGCACGGTCGATGACAGACCCACGAAGCCAGTCGCCACACCCGTGGCG
AGCGCCACCAGCAGCTTCGCCGTGAAGAAGAATCGGTTCTTGTACTTGTACTCCTCGTAGAACGGACCGTAGCGAGCGTTCACCGTCTTCTTCATGTGCT
GCACCGTGCCGACGTCAGCGATCTCCGCCTCGTGCTTCTTCACCACCACGTAGCCGTACAGGATGATGCCGCACGCCAGGAACAGCAGCGCGCAGATCGC
CAGGATGCACTTCGGGTCCGTCGCGTTGTCGTTCGAGAACGAGTAGTAGATCTGGTACGTGCCCGTCACACCAATGATGTACTGCGATAGGATCGCCACG
AGGATCTCGAGACCGATCATCTTGTCGAAGAACTTGGCAAGGAAGTCCTCGCGCGACATGAACAGTCCGGAGATCAGGTAGCCCAGGCCGAACAAACCCA
CAATGCCAGCCATCACGCAGATCACGCCCGCCAACGTCACGATGAACAGCATGCTCTCCTTGATGCCCACCTGGCGAGCGTACTTGGCGATGCCCTCGAT
GCCAGACGACGACGACGAGCTCCCCGAGCTGCCAGAGTCGCTCGACAGACGACGGCTCGTGCTAGAACCCGACCCGCTGCTGCTGGTGCTGCCGCTGCTG
CTCCCGTCGACCGTCTCATCGTCGTCCAGCTTGCCAAACGGCAGGAAGATGAACGCCGACGGCGCCATCTGCTTGCCGAAGAGCGACAGCGCCGAAGACT
TGCCCGGAAGCTCCAGCTGGTTCACGAAGACCGCGAATTGGCAGAGCTCGATCGTCGTCACGGCAGCTCCCGACCCAGCCATTGACACCGAAGCCGTCGC
AGAGGTACCCGTGCCGACGATGGTGCTGGCGACGGCGGCGATACCACTGATCACCACCGTGACGCCGGCGACACTCTTGGACGTCGCGGCAACAACCGTG
CCGGTGGTCGTCGTGTCGTCCTTGGTGATCACGCCGTCCTCCTCGTCCTTCTCGCGCTGCTCCTTCTTCTGCGAGTCCGACGCCGTGCTGTTGACGAGCA
TGGCCGAGCACGAGCACGACGAGAACGAGTCCTCCGACGTGTACGAGCACTGCTGCGTCGAGCTCATCGTCGAGTTGGACAGGAAGTTCGACACGGTGCT
CGAGCGCTCATTCAGCGCCGCGATGATGGTCGAGTTCATGAACGAGTCGAGCTCAAGACCGTTGTACACGGACGAGGCGAGCCCATTGTTCGTGCCGTAC
TCCCACGCGCTGTTGGTACAGGCCGGGAACGAGCAGATGGACACGCACGTCGTGCCCGACAGCGACCCAACGCTGCCGCTGTAGATGACGCAGCTGCTGG
CCGACACGGCCGAGTCCACGTCGATGCTCGCGCCGCCGCACGTGAGCCCGAGCGTGTCCCACTGCGAGTAGAACGTCGAGTCGCACGTCATGACGTCCGA
G