Description :
From Genome Similarity Track
Location :
Scaffold_6:139325- 141589
Sequence
2264 bases(100 bases per row)
CCTTAATGGCTGATTTCGTCTGGCACGTCAGCCCATAATCTCCAATCAACGAGTTAAACACAGCTCGCGATAACTAGGGAATATTTGCAAAAACAAACGC
TTTATTGTTAAGAGCCAATTGCATGAAATTGATGGCTCCAAGAGATAAAGATGTATGATTTGAAAACAACTGGTCCCTGTGCTCTCCAGCTGCTTTTGCT
CAGCAATCGTCATTCCGACATCTTTGGTCGACACCACAAGTGTCAGACGGTACATTCTTTGTGCAGATGCGCCTCAGTCATCTCACACTCCTGCCTTCTG
CTACGTTTGCGGGCATGATCCGACACCTCGTAAAAGTGACGGATTCCGGTACTATCAACGAGGCCAGCCACTCCGTCCCTCAGTCCTCTAAGGCGCAGAC
ACAAGATGGACATGGGGAGAGGGTGATAGGACTGCAGCCTGCAGAAGTGGAGAAAGCAGTCGCGCTGGTTGGCAAAGAAGAGAAGGGTGGACTGGTGCTG
GACACGCAGGAGGTGTAACGCGTGCAAAAGCTCGCTGACAAGTCTACCGATAACTTTCAAAGAAAGTGGCTACCCCCGGATCCTTGGCTGATGATCATTG
ATTATCCAGGTGTAAAAGAGCTTTTCGACGCGGAGCTTGCGAATAAAAGAAGTGACATCAAGGAGTATGCTCCTCGGGCGTGGTCGAGTGGCCTAATTAA
TGTGCTGCCGCAGATTACTGACGAAGAAACCGCTAAAGGTATTATAATTGATATTATTTCAGCGAGTTCTGAGTCCGAACTAACGAATACGGAATGAACC
CCCAGGTTCATTTTTTATTCGATGCCAGCGTGATTCTGGCTGATTTATTTCGGCTGCTAGAGGATGTCCATGATTATGATTCCTTCTCACTAGCTGTCAA
GGAACTCCTGAAGATGGTTTCCAGCACAGCAGAGGACGAGGATGACGTCTTGTCCTACGCCTTCTTCATTCATTGCCACGAAAATCCCAAACAATTTTCT
TCAGACTGTATACAATGCGATGCATGTGCATGAGCTAGACGTGGACACCTTTGAAAGGGTTATTGACTGGGTGACTACCAAAACACCGATAAACCGAGTT
TATAAATAGTGTTTATAGCACCCCCATAAACCACATTTACAAACGAATGCGAGCAAATATTTATGCAATGTCGTGCCACCATAACTATTCGATAAACCAT
TCAAGTAAATAGAGAGAGATATTCATGACTGTCTATTACCCATTATGATTATATGCTAAAAGTCTGGATTCGTCTAAGCCAGGCGAGGCGGTGATACGTG
GCACCGTGCTAGAGGTGGTGGTTCGACACTCCACTCTAGGGTAAAACGTTTAAGACAGGCATACAACTGAGCCCCTTGAACTATTGTTTCTGCGCCTCTT
TGTTCTCGCATAGCCAAGGTGAGTAATGACGTACACCCGTAGTCGACGAGCGTACCACACTGAAAGACGTCGCGGATTGCGCGCCACAAAAACGGCACCT
TTTCGCTCACACCATAAGTGCGTGATGCAAATAAAGCACATAAGGAACCATATACGTCGCCACACATGTTCTCCCGCCGCGACATCATCTTGAAACCTCT
CCACTAGTCTAGACCGCTGAAGCACTGAAATTTCCGGAGCCGGACGGTTGGCACAGTAGCCGAAGTATCTAGAAAAGACACGGGAAGTAGCGATAGAACC
AGTCAAATGTCTGAGAGATTTACCCCAGCACGCACGCGCCTTCGGCACTCCCAAAACAAGTGTAGTGAAGTCTCAGGCACACCTTGACACTCCTGCAATA
CACGGCAGCTATTTTCCGTGGGACGCCCTGCATGATATATATTAAGCTGCTTGGTAGCGATGCGATACGCCGTCCAAACTAAAAAATCGGGGAGCCCGTT
GTCATGCTTTCAGACCTGGGAAGGAAGCTGATGGACCACCGCCCATCGCCACGTATCCGTGCTAATAATCGAATTCAATCTCTCCAGCAAGGGTTGGCGT
GTCTACCTCGGTAGCTCCGTCTCAGATACCAAGCAGTCCATTGGCGGCCTACTTTAAGCGAACCAGACCAATATCTGACAGCGAACGACCTCTGCGAGTA
CCTACTATGCAGCCTCGGCGCTCAGTTACCCATTTAAAGTCATGACGAAACGGAAGGAGGAAATCGAATCGACAAACAGGCTCCAGACCCAGTTCCGACC
GAATCGGGAAATCAAGTGACGCCAACAAAACAGAAGTCGCTCATCGCCGTAATTTGGGCTGGCA