Description :
From Genome Similarity Track
Location :
Scaffold_1086:1393- 6547
Sequence
5154 bases(100 bases per row)
CCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGA
AAGTTCAGCAGAACACGGATCATCGGGGGACCCTCCATTAGTCGGTGTCTGGGCGCTGTTGGTAAGTTGGATACAGCAATCTCGCAGATTTCGCTGATCC
CGCTACACCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGAAG
AGGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGAGGT
GGATCCGGATCCGGATCTAGAAGAGAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAAGATCTGCTAACAAAA
CAAGGGAAAGTGAAGGCGAAACGGTACGCATTGCAGATTCACCGGTTAAGCCAACACCGTACCTAAACCCAACCCCGCTAGTCGAAGCAACGAGAAAGAA
GACGAAAACAAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCTCGAG
TTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATCCAAGGGAACCGGTGA
GAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAGGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGCTCGAAGCAGACGA
TATCTTCGAGCTAGACTTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGCACTATGGATCTA
GTGTCGTCACCGAGGATCAGCCAAGCTGCATCCTCGAACTACGAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAACCACGACGCATGACTTTAG
GACCCTCCGGGGCATCCATGCTGGAAGCGCTGGCGAGGATCCGGGGACAGGAAGTCCCTGTGAACGTGAAGGCTCGGGATCCAGTACGCCCTACCCGTGA
TCTGATACAATCCAGCCAGGATCGAGCCAGATCCGGCAAGAAACCAGTGGGGTTATCGTCAGATCGGGCTCAAGGTAATCGCCTCACAGATCCTGATTCG
CCAGTGGACCAGACGGCCACAGGCTCTTCCGACACTTCCTCGGTCACCCTGCAGCGACACTTCAAAGCTGCGATGAGTCGTTTCCTGGCCGAAACAGGGT
ATGAGAGCGCCCGTGCCACAAGCGCAAAGTGCTCCACGAACATGGGACACGAGACGTGGAGATGGGAGTCAGTGGAGGGAGACAACTCTCATGATGAGTT
CGACCCAGATGATCTGGATGGCCCATCCCCTTCATCAGCGGTGGTAACCACAAGCGCAGTCGGGGCGGGTGGATCGTCCATGATTCAGAGGGTACGGATC
TCAACCATATCGGATCTGAAGGAGTTCACGGGCAAGGATCAAGATGAAAGCCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGGCC
AAGCCTCGGATGCTGAGAAGTGTTTGACCTTTGCGGGTCTGCTAACCGGCCAACCAAGAATTGGGATCCGCACCGGGCCGATCCCCAAGAAAAAATGGCC
AGGATCTGCGCAGTTCCAGACACAGTACTGTGGATTGGGAGTGTCGGTGGCACGACATACTACCATGCTCGCGCAGATCGGATGAATCCCCGTTAGAATA
CCTACATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAAATCAAGGATGGGGGATCCAAGGTACTGCGGGAACACGTGGATCATTTCATCGAGACG
TTGGGAGACGTGGATCTGGTCGACAGGCTGACCCTGTTACGACTTCCCGACGCAGACGAGCTTGAGGAAGTGCTGCGGGCGGTGGATCGCGCGAAACACC
GCCAGAAGAAGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTCCGACGCCTACGGCCCCAGCTCGACGTGTCCACCAGGTCACGGCGCCCGACTC
AGGAACTGAATCAGGATCCGACGGCTCGGACTCCGACCCTGAAGATTACCGTCAAGTCTGTCTCACTGCGTCCAACGATCGAACGGCGAAGACAGGAGAC
AGCTCTCGACCGGGGGATACCGTACCCGGGGGCCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGGCAGCACAAGTCAGGTGTTCGCAGTGCGGAT
CCCGGAAGCACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTGGCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGGGTCGCGG
GTGTGGCGAGATTCACGACGTCGGCAAGTGCCCGATGGAAGAATTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCACCGAGGGATGTTGCCA
GAAGTGGCCGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTACTGCATTTATGCATTTGTGAACAAGAC
ATCGCTAGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGATCTCTAGTTTGCGCCAAGTGGAT
GAGTTTGCCAGATCCGAAGTCTCTTCAACCCTGGATCTACAAAGGGGAGAGGCACGTGGTTATTGGGAGAAGCGCCAACATGGTCAATGGTTTGAGCCTA
CCAAGGGTAAGGTCACTGCAGATCCACCTAAGGTCTGTCTGGTCACTGGATCCTCTGGATCTGAGGATGTTGGATCCATGGATCTGCTAACAGGGGAGTC
CCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGTCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGT
GGTGCCGAGGTGTCTATACTAGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAGGCG
TGTACCGTACGAATGGGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTTGGTATACTGGCTCGATATTTGGGTTGGAGATCTCGCGGGTCAAGACGC
CATCCTCGGGATGGATTTCATGGTATCAGCCGGAGTAAGCTTGGATCTGGCAGATGGAACACTGTGTTTCCCGGACGAGATGCGGATCCAGCTCAGCGGA
CGGCGACCATTGTACGGGGCGAAGATGAGGATCATAAGGGCGGATAAGACGACCTGGATTGAGCCCGGAGAAACCTGGGAGCTGCCAGATCGGTTAAAGT
GGGTGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGAATGCCTACCGTAATCCAGGGACCAGGTCGATCACAATACCTCCAGGTCACGAACGT
CAGCGACAAGAGACTATTACTGGACCATTATGAGGAGATCGGGCGATGGTTGGCGAAGGACGGTATCCCTAGGCGACCTGGATATGTGTCAGTGGGATCC
CGTCGCTACAAAGAATGGCAGAATCTGGCGTACGAGGCGACTACCGAGATCGAATCTCTCGGAGAGGTGGAGCTCCCGGCGGGGCCAACTGGCCCCTTGG
TGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGGGATCGTCGGATTGAGATCCAAGCGATAGAGGTTGGATCCAAGACTGGGGATGATCC
CCAGAGCAGGCCCCTAGATAACTCAGGGTCGGTGGATGAAGGATCGCAGAGGGCTGAAGCCGGGTCGCCAGATCCCGCTGACCCCCGAGTGGATCCTAGC
TGTTCATGGGACAAAGTGCCTGGATCCTTATCGCGAATGGCAACACTAGTCAAACAGAAACCGTCGTGTTTAAACTCGCTCGATGATCAAGTCGATCCAA
CTGGTGGCTTCCCCGGTACCGGGGTACCGGATCCCACGAAGACAGAAGGAATGACGAGTGAAACAGGGTCGCGGTGCTTAGAACCAATGGTGGATCCGAC
GAAGACAGAAGATGAACAAGTCTGTTACCATGAAGGCGGGGATCTACACGCCGATGATATCGGAGAAGGCCTGGCGGTGATCCCGGAGGTACCACTGACC
ACAGAAGAGGTCACGGTTGATGATATCCAAGTGGAACCAGGGACGAACGAGCCCGCGGAAGTGGATCGGTTACGTCAGAAGATCTGGGAAAGCTGACACC
TGCTGATTGGTAAAGGTAATGCATTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACACGAAACCGATCGCTCAAAGGGTGCGGAA
GGTGGCACCTCAGTTCCGAGACAAATTATCGGATCTGATTAAAAGGCCAGCTGCAAGCCAAGACCATCAGTTTCTCAACGTCCCCGTGGGCATCTCCGGT
GGTAATCATCATCAAGAAGAACGGTGTGGATATACGTCTGTGCATTGATTACCGGCTAGTTAACGGCCTGACCCGATTGATGGTGTATCCAATGCTTCTA
ATCAATGAGCTATTGGAGGATTTGGATAAAGTACTCTGGTACTGTTCTCTTGACATGGCCAGTGGTTTCTGGGTGGTGACTATGACGGATCGAGTCCGCG
CAATATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGAATTGAAGAACGCACCCCAGATCTACCAACGCCTGATCGATAA
CGCCCTCTATGGATTCACCCGAATACCGGAACCCGAAAGGGGTGGATCCGGGGAAGATCCTACCGAAGTGGATCCATTCGAAACTGGAGAGCCAGGGGAT
CCTGGGACCCCGTCTGTCTTAGGACGCAGATCTTATATCAACGACATTCTAATCCCGGCAGAATCGTGGGATCAGCTGTGCGAGAGGGTGACATCCCTAC
TGGAGGCGTGTACTAGGTGGAATCTCTCTATCAGTGTGGTAAAGAGCTATTGGG