Description :
From Genome Similarity Track
Location :
Scaffold_2432:1393- 3090
Transcript NameFunction/comments
Phyag_g12464abc transporter

Sequence
1697 bases(100 bases per row)
TGGTCTCGAGCACCGTGAAGGAGCCGAGCAGCGAATCCTCCTGGGCAACGTAGCTCGTCACGGCCCGGAACGTCTTGGTCACGCGGGCCTCGCCGTTGAG
TTCGATGTCGCCCGTGACGTCTCCAGAGCTGATGCGGTCGGCCAACAGGTCGACGAGCGTGGTTTTGCCGGAGCCGGACGGGCCCATGATGGCCGTGAGT
TCTCCGGGTGCGCAACGTCCGCTGACATTGTTTAGGATggtcttcttgccgtcgggTGCGTCGTCCGACTTGCGGCAGGCCACGGAGTAGCTGAGGTTGT
TCCAGCTGAGCACGCACGGATTGGTGAGATGCTGGTAGGACGGCTCCGGTTTGCCACCGGTCTCGAGAGNATTCTAGCATTGCGTACGATAAACCTTGTT
GTGAGCGGGGTGACTCCAGCATGACAGCCATGGCAAGGACTCAAACGAGGGCTTTAGCGATACAAGTTATCACTACGCTAGTGCTAGGACTGTTGGGTAA
TGGTGTTGTCTGGTGAGTGAATGAGAGATAATTTGCATTGTGCCTGACAATCGGCCACCAGATATCCAGCCAGCAGGCCTGACACCTCGGATAGGCATAT
ATATCGGGTCAGGCGTGGCGTACCTCAGACAATCTTTGCATCGCCCACAGATATCGGATGAGTCACCAGTGGATAGATGATCTTGTCTACTTGTAGTAAG
CTTAGACACCTCGTTGCCGGTGGTGGCTCGCTAGCAACTGCATCGAGTCCAACCAGCGCCACAACTCGGCCGATCAACGCGTTGCAGTCCTTGCTTCAGG
ACTCAACACTTGACACATTTGACAGTCAGAAGGTCATACGGTGAGGAGTTCACCTTGAAGACGTCAAGCAAAAACCGTCGGCCATCTGATGGATCACACC
TCATGCAATACATGGTAACCCATCGGACCAAGCCCTTGTCGTGATGGCCTGCAAAATATCGCTTGGTATCTTGGGATAGCTGGTGTCGAGTCCTACTTGG
CAATCTGGAGTCTCGATTCGTGGACCACCACGCCTGACTCGGCTTGATTCACGCCTGAGGCGGCAGGTGATCCTGTCAGGCGTTGCAGTTCTTGTCAAAT
GGTCGTCCGGCACGATTTGCCATCCACAATGATCTCTCGGAACCTTCACTTTCACCTGCAACGGCGGCATGCCCCGGGCTTTTCGCGTCGACACCAACAT
CTCCTCACCCCATGCCGTGTATATGTAGCTGCGCCTGACTCGCGATACGCCGACATCCATTCGCGCCGGTCAGACACCTTGGCATCCAATCTGCACAAAA
AATGACAAGAAACGTATGCTGCGGCACCGCATGTGTGCCTGACCTCGCCTGACCGCCGTTGCGTCGTCTACACCAGCGGCACCCGTTACTGACCCGTTGA
TACAATGCACCTCATCGCCGCGTCCctgttgcagtgcaatgGCCAGGCTGGAAAGGCGAGACGCCTGAGAGCTCAGGAACTGGCCAAGGATTTGCACATT
TTGCAATTCGGAGCTTGCGTAGTGGCCACCTTGAGCTGCCGGTTCCACCCGGTCCGTCACAATCCAACTCGCGCAGTCGGAACGAGACCGTCTCCGTTCC
TCCACCGGTAGCAGGGCTAAcagcttgtgcttcttcgtgctggaccCGGACCGTCACCCGTCGATCACCGTCATGGCATCTCCACTTGCAACGCCCT