Description :
From Genome Similarity Track
Location :
Scaffold_5:1392992- 1408412
Transcript NameFunction/comments
Physo_303307Crinkler (CRN) family protein
Physo_348168ribonucleoside-diphosphate reductase small chain
Physo_508242conserved unknown protein
Physo_511192ankyrin-like protein
Physo_334825ankyrin repeat

Sequence
15420 bases(100 bases per row)
AATTGTGTACCAGCTGCTGGTTTTGCTGTCGCTCGAGCATTTAGCATGCCGTCGTCGCCCTTCAATAGGACTACGTATCCGCCCGCAGCAGATACGGTAG
ACAAGTCGTGCTGTCGCGGATGCAACGGCAGAGGGGCGGGTCCCTTTGAGAGGGGGCAACAGGGTGCGAGTAAGTGGCCCAGCAGTGCTAACCTTCGACG
TCTTGGCCTTGAGAACGCTCGCAGATTTTTGATGCATGATTTCCTGCGCAAGGTCGTGAGTTGGAGGTCACCTCGCGGACCGCTGAACTGACCAGATCCC
CTTGACGTCCAACTCAGAGACGTTGCTCTTGCCATTTAGTTCTCGACTGTGGCCGTGAGCAACATGGGACGCAGCACAAGCTCTCGAGAGCGAGGCGAGT
TCTGCGTAACGCTGCGGTTTCTGACTTCCGGGCCCAAAGCCAAAGCGACATACACCTGTCTTAACGTTGAAGTGGTCAAGACACGTGACGAATTAACTGC
TCGGATCGGTCTAGTCGGTCCTAGGAACTTTAGGATCTTGATTGCTTGGCTACTGCCTAGTACGCCGTGAAATGGTTAGCCATCGGACTTGTAGCTGCAC
TGAGCGGTAGTCTGCAACGAGAAAAAAAACCTTCGCGTTTCAAATTGCTAGTTTTGGTGGTTTTGCGACATTCTCATCGGTCATTGCAGGCGCTGATGTT
TTAACTTCGTTGATCGCAGCAAAAGCTCAACTAAAGCGAGAATTTGTCAATTACACTCAACATCATTTCCATTCGGAAGCGCATCGGCATGTGCCTGCGT
TTCGTTAATGGATCCTGTCCTGCTTCACCAACAGAGAACAAAACGTGTTGCAGCTTTCATCGAAGCGAACCCGAATGATCTTGACTTCGGGGAACTCTTT
CACGCTGTTCACTTCAGGGGAATTGCTCCCAGGCGGAGTAAAAATCACTAGGAACATTTGCTTGGCCGAATAGAAAACGCGATACTCGTCAGCTTGCCGC
ACCGCCCCAACAACCGCGGTTTCGTCTGACAAGCCGACTTTCACTTCAAAACCGAATCGAACACTTTCGTCCTCAACGATAATATCGGCTCTGTGTGCGC
TGTTGGGCGACTGCGCTTTGAGACGGTCTCTCGTAAACCGTTGCGTCTCCTTCAAAATATCTCGCATCGTACAGAACAACTCCTGGTGAAATGCTGCCAC
AGGCGGACATTTATCGTTTCCGAAGACAAGGTCTGTAATGACCTCTGGTCTCATCTCACGAACGGCAGCAGATAGCAGCACCAGCGGGTCTCCAGCATTC
TCAATAGCTTGTACATCTCGTTCGGGCAGTGCTTCGACACAAACGCGGTGCACCGTCTCGGAACTTTCCATCCATTGCTTGTACCAGAATTCCCACGTCT
AGCAATTTGTCGGCAATCTTCTCTCCACTCGTGATAGACTCGCCACAAAGTGTCTGCAACTCCCTGGCGGTCACGTTTTTTTCCTGAAGCGCATATTTCA
GTGCTCGCCTCTCCAACGCTGCCAAGCCGCATATTTCCTTATTCATACAAAAGTACGCGTTGTTGAGTAGCAGGTAATCCGAAAAGGCAACCAGCTTAAA
CCAGGGCTCCTATTCACACCACTCTTTCGTCCACTTCGTATGCGTAGCCATGTAGCGAACCAGCGAACCAAATACGCCAGGTGCGCCACCAGAATACTCC
ATAATCGCCTGCCGAAGAGACTTCGCAAAGTTAAAACATGGCTCGATCAGCTCGAAAAACGCAGCCATCTGCATCGCTGAAAATGACTCGGCTTGCAACA
GCTTGGTTTCAGCGTATAAGCTAGCACGTGGGTTGTCAGAAGCAAGCTCATGGTGGCACGCCAAAGCGGAACTGCCGACCCCAAGGAATCCATAAAAGTA
GGATGTCACCTTTAACTCACGAAGCACCGATAGAAAGACCCTTATCAAAGCTCGGTCCGCGGACAGGGAGTCCAACCCGTCCACGATAAGGCACACCCTT
TTCTTCGTGCGCGCGGCGGATGCCTCCACCACATTTAGCAATGATACCGAGTCTGAGCATGTGCTTTGCGTGTCGAATGGATCACCCAAATTCTGCCCGA
AGTGGGCTCCGTTTTCGATACCCAGCAACTCGATAGAATCGCACATCACATCAGGAACTTCAGCAGCCAGCCAGGTGTCGATCCGTAGGCAATGGTTGTT
TTCCCAAACTGTCGAGGACCATAGAGCAGAAACAGCGGTCGTTCAGGTAATCTTGTGTCGGAGAACCCCTGCTTTATCGTCTGGAAGGCGGCGATGCTCT
CCAATGGAACCGAGAAGTAGCCCTCGAACACTGGCACTGCAGGCGCAAGCCGTGATTGTAGCAGCCTAGGCTTCTTTCGTGGGGATTCAGTTTCAAGAGC
GTCTTCGAGCTGATCCATTTTACGGGAACCGAGTTGTGACGCTGGATCAATCGCAGAGAGGCTTGGCACTTCAACAATGAGCGCACTCTGCTTGGTCTCC
AATCTGATCATCTTCGCCCATGGCTCATACGCTTGGCGGCTCTTGAAGATCTTGAGCTTACACGCTTCCACCGGCGATTCAGTTGGAGTGTGTGGCAAAA
GCATCTCGAGTACTATTCCACGAAGAGCGCCTGCACTGCTCTCTTCAATTAGAGAGACCGAATATTCTCTAGTGCCCGCAAGCGTGTCCCGCGTACCAGC
ATCCACCAACAGAAACCAAAACTTGGTTCTGTTCCCAAACCAAACCTTGGGAATCTCCACGAGCAGCGGGTCGACAGGGCTCTTCCCCAAGGTCCCCACA
GATTCGGACACTTTCAATGGAGTCTCATTCTGGTACGCAGCCATGTTGGCGAACACGTTGAGGTTCGAGGCAGTTAAATCAGCGGGAAACCAGCAAGAAA
ACGTAGGAAAAGCTGCTCTGCGGAAGGAGTCGACGGATGTACTGCTCAACACAGCCACACACTTCAGGGGAGCAATTGGTCCTCCTTGTCTGTTCACCAA
CTGGAACCACGCTTCTTGCTCCTCCTCCATCGCTCTCCCTTGTACTCCAATTTCGGTAATGAAGTGGGTGTCCATCCTACCACTGACTTGAATGCACTCG
TGATTCAAGTGACTTGAGGCGTTGTGACTTGAATTTCGACTTGAAATCCTTCCATTAGCACACACACGCACAGTACTACGTAGTATTGTTAGATACTTCA
GCACAAGTTTCTACTTGCAATTCAATCTATAGACCCCCCCTTTGGTGCGAGTCCGTAAAGGCTCGTGAGCTGGAACTCGTTCGTGCAGTCATTGCTTAAG
ATCAAGGCGAACTATCAACCGACACTGTTAAGGAAGATCACTTCAACTTTGGTCGCTAACTCGATACACGATGAGCAGTCTGCTGGAAGCAGCATCGTCC
TCATCTCTGATGAATCGGTTTCGAATGAACTAGCTCACTCCGCGGCTGCCTCCCCAGACGGAGAGGGAGCAGACGAATCTTTCCTCACCCCCTCACCCTC
CGACGCTATAAGATTTTAATCCGAGGCATGTATAGACGCAGATGTCGGGATCAGGAGCGGACACCGGTACATGTAAATCTACGACCGTGATGAACGGTCC
CAAACCCGACTTTATTCAGCTGTCAACGCGCGGGATTGCGATCGAGCTTGGTCGGTCTGCCTGTCAGCGTTCCAAGCGCTCAGCTTGTCATTTCGGATCT
AACTCTCGACCCAGCAAGCGACTCGACTCCCCTCTACAGACCTCTACCCAAGCCGAGCATTTCAACTCCTCGCCGCATCCATCGCCTCCACCGAGCAGCC
AAACCTCCAGTCCAAACCCGCTACAATGGTCGCAGCCTCGACTGTGCGCGCCGCGGTGGTCGCGTCGCCGGAGCAGCCGGAGCAGGAGCTGAGCCCGCAC
TTCGCGGACAACTTCGCCAAAGGAATTGTCATTCACGACAACAAGTCCCAGGAGGAGGAAGAGCAGCCGAAGCTCGAGATGTCTGAGTACAAACGCAAGG
AGGTTAACGGCGAGCTGCAGCCGGAGCCGTACTTGGTGTCGAACCCGAACCGGTTCGTGCTGTTCCCGATCCAGGAGCACGACGTGTGGCAGATGTACAA
GAAGGCCGAGGCCTCGTTCTGGACGGCCGAGGAGTTGGACCTGGTGCACGACCTGAACGACTGGCAGAAGCTGACGGACAACGAGCGGTTCTTCATCAAG
CACGTGCTGGCCTTCTTCGCGGCGAGCGACGGCATCGTGAACGAGAACCTGGCCATGAACTTCAGCAACGAAGTGCAGGTGCCCGAGGCGCGCTGCTTCT
ACGGCTTCCAGATCGCCATCGAGAACATCCACGCCGAGGTCTACTCGCTGCTCATCGACACGTACATCAAGGATACGATGGAGAAGAACCACCTGTTGCG
CGCTATTGAGACGATCCCGTGCGTCAAGAAGAAGGCGCACTGGGCGCTCAAGTGGTGCGACCCGCGGGTGTCGTCGTACCCGGAGCGTCTGCTGGCGTTC
GCTGCGGTTGAAGGCATCTTCTTCTCGGGCTCCTTCTGCTCCATCTTCTGGCTCAAGAAGCGCGGCCTCATGCCCGGCCTGAGCTTCTCCAACGAGCTCA
TCAGCCGCGACGAGGGCATGCACACGGACTTCGCGTGCCTCATGTACTCCAAGCTGGTCAACAAACTGCCCGAGAGCCGCGTGCACGAAATCGTTCGTGA
GGCCGTCACCATCGAGCACGAGTTCGTGTGCGACTCGCTGCCCGTGGAGCTCATCGGCATGAACTCGACGCTCATGTGCCAGTACATCGAGTTCGTGGCC
GACCGCCTGCTGTACTCGCTGGGCGTGCCCAAGCTCTACAACGTCAAGAACCCCTTCGACTGGATGGACATGATCTCGCTGCAGGGCAAGACCAACTTCT
TCGAGAAGCGTGTGGGCGAGTACTCGAAGGCCGGCGTCGGCGTCGCGGCCGAGGAGCAGGTCTTCACGCTCGACGCAGACTTCTAAGTGCGGCGTCGATG
GGGTGTCCATGGTGTGATTGGGTGGGCTCTGCGTTGGCCATGTCTAAGTATCTGTAAGTTTGAAGAAGCAACGGCAGTTGTAAGCCAGCTTCGTCGCGTA
ATTAAAAAGTAAATGTTACGAATGTTATCCTAGCGTTCAGCAGGCCGGCAAAGATCTGATGCCGCGTAGGCCCCGCAATTATTGTAATTGAAGTTTGGTT
GGGCAGTTGCGGCCCACCAACAACATCCGCAATGTGCCGCCAGCCATTATTTCCTGCCAGCTACTTCGACGTATTATATTGTTCGGTTCGAGTGTCGTCT
TTGTTTCTTACACACAAAGACACTGAGTTGGCTCGACACATGATTCCATCCCCCTACTTGTTTTTTTTTAATCAAAGATGCAACATGGCAACATAGCTGA
TGTAGTTGCGATATTACATTACCATAAGTGCTTCATTTGTACTCAGTCTGTACACGAACTGATAAAACAACGTCAATACTGTATCACCACGCTATTCCCG
CGGTGGAGTACGAAATTAGGGATATTGGTCGAGAATCCAGGCGTAAATCCCGGTTTCCTTGTGGCGAGCTGCCAATTCCACGGTCTCCGCGGTGCAGACT
TGTTTGCATTGTGAGTACAGGAACAGCAACAGCTCGAAATTCCTGTGATCGACCGCACTGTTGATAGCGGAGCTTGTGCGTCCTTCCGAGCAATGAGTGT
GGAGCCATTGCACAACATGAAAGTGGCCGTGCAGCGTCGCCTTGTCCATCGCCACCGTCGTGCATCCTTCACCACGATTACGGTGCAACCATTTGACAAC
CGCCAAGTGACCATTCTCTGCTGCTCCGTCCATTGCTGCGACCGTGCACCCTTCACTGCGATGTTCATGCAGCCACTGGACAATATCAAGACGCCCCTTT
GTCGCCGCTCCATCCATTGCGTCCGTCGTGCAGCCAGCGTTCAAATTATTGTGCAGCCATTTCACAACGTCAAGATGTCCATTCGTAGCAGCGCCGTCCA
TCGCCGCGGTTGTATATCCTTTCGCTGTGTTTTCATGTAGCCACTGGACTACAGGCAGGTGGCCTTCTGATGCAGCACCATCCATTGCGCGACTTGAGCA
GCCCTCCTCCCTGTTTTCATGAAGCCATTTGACAACCTCTAAGTGCCCATTTGCCGCAGCACCATCCATTGCTTTACTCGTGCACTTGTATCCGCCTCGA
TTGGATCCATCCCTGTTGCGCTTCCGACTATCAGCGGTAGGAGCTCCAATCTTCTGCATCGACTTCAGCACCCTCAGGTTTCCCCGCGCAGCAATGGCAT
CCATCGGTGTTCCATCGGCCTGTGTCTACTGACGACCGGTACTAAATGCGCTGACTTTTGGGTCGTAAACGTACTCCACCCAGAGCCACTGCACGACATG
AACATGACCATTCTTCCCGGCTTCGATTAAAGTATCGATCGTGACCTTGGCAGCTTTGCACAATTCTCCAAGGCGTATTTTCAGACTTCGAATCTGATGA
AGGTGTTCCTCGTTTTCCACCGCGCGCTGATAAGCATTCAAAGGTTTATCCGCCCGCGCTCGAAGGTATTTTGCGATCTCAAGATGTCCATTTACCGCCG
CAATGTGGATTGCAAGACTGGCCTCTCCTCCCAGATCCGTCAGTCGGCTCTGATTGTCATTTGCATGACTCCTCAAGTCCAGGTCCAGCAGCCAGCGCAC
AACCTCCAGATGTCCATACTCCGCTGCCATCAACAACACCCCACCAGCGGTACTTCGCATAGGTTCATTTTTCTCGAGCCACTGGAGCACATCAAGGCGA
CCTTGAGCTGCAACCTCGTGCACTAAATTGTGTCCTATAGGCAGCACCAAAACAGCACCATGAGACAGCAGCCACTCTGCCAGAATAACGTCCCCGTTCT
TGACGGCGTACTGAACAGCCTTGCTCCTATCGTATCTCACGTCTGGAACGTGCTGCAATAGCCACCACACGACGCTGTTGTGGCCGTGCAACACCGCCAC
CTCCAGGGCGTCTCTGCTCCAGTGAACTCGATGCCCCACGACAACTCGTTTGCTGGGACTGGTAGCTTGCAGTTGCGTCTTGAGCGAAATGTTGTCGTTA
TCACGGAAAAACTTTAAGATGTCCATGGCTCCGACACTGACGGCGGCGGTCACCACCATGGGGGTGATCGGGTACCCCTGGAAGTTGACAGACAGCGACT
TGACCGAATCAAAATGTTTACGCTTCACCGCCTCATACAGTGACCGGTTGAACTGGTATTGACGGTAATACCGGTCACTTCGGAGGTGGCAGCATTGGAT
GGAGCAGCAGAGAATGGTCGCTTGGCGGTTGTGAAATGGCTACATCGAAATCGAGGTGAAGGATGCACCACAGCGGCGTTAGACCAGGCAGCGCAGCAGG
GCCACTTCCACGTAGTGGAATGGCTTCACTCCTATCGCTCGGAAGGCTGCACAAGCGCCGCAATCAACAGCGCTGTCGATCGCGGAAATTTTGAGCTGTT
GCTGTTTCTACACTCGCAATGTAAACATGTCTGCACCGCGGATACCGTGAAATTGGCTGCTCGTCACAAGGAAACGAGGATTCACGCGTGGATGCTCGAC
CACTATCCAGAATTGCGTACACGAACGGGGGCTGCATGAGAAACAATTCGTCCTCGTCAAAAGATCGGCGTAAATTGCCAAACCACTTTCAAGTCAACTA
CGATGGACTCAGACGATCCTCGGTAATTCAGAGTCACCGCGACTGTACACCACTCGGCAAGCTTCGGCTGTCTGCGGCAACCTAAGGCACCGCGACTTTT
ATTTTTACTATTACTTCGAAATACTTGTTTCTTCTGACGATGCATCTACTGTACATTTACGTTAAAAGTCGATGGAATTTTGAAGCCGATTCCCCTCGGC
AAAACTGTAGTGCAGGTAGACATATATACAACTCCTAAGATTAGAGCCGGCTGAAAAATATTCTCGGAGGATGAGCCTGAAAAAAAAACCTATTCAGTCC
CACCTTTCACAGGAAGCCACGACAGTAGTTTTAGATGGATAGAAACAGTCAAAACGCATCACTTTCTTGTAATATTTTTTTAAATGTTCTCACAAGATAC
CGACTTTATTTATTTATTTATTTTTTGTGATGATGATGAGGTATATTGAATTACTTAAAAGACGTACCGACTTTATTGATAAGAGCCATTAGTTCCACCA
CAAAAGAATTCGGCACAAGTGACCTCGATGGACTTTCGAGACGAAGGTAAAGCTGTACTCTTGCGTGAACTGAAGCAAATATTCACCTTACTAAGTGCAA
ACCATTTTTTTAATACAGATTCACTTCATCAGATAGACAACAATCCTGTCGTGAATGAACCCACGCATGGTGTCGTGTCGCCTTTGCTTGTTGTGGAGCT
CCTCTTTCGATCCAAGAGCAGCTTCATGGGCCTGTTGCACGTCACCAACTCCGTCTCACAGTTCCTTGACTCGTCGGTAGAGTTGCCGTTGCACAAGGCC
TGTGCGTTTGACTCTCTGCGACTACTGGACCGCATCTGGGCCTCCTCTGAGGCCTTCAACCAAGCCAATTCTACCAATAGCGGTTGTAGTTAGTCTCTCC
GGAGTCACCTCCGCTCCGACCGCTACTACTTATCTCCTAAACCACTTCAACCTGTCGCTGGAGGAGGCAGTGAAGCGTAAACATTTTGATCTGGTGAAGT
GGCTATCCACTAACTTCCAGGGGTTTCCTATCGTCTCCCAAGTGGTGACCACGGCAGCCACTGTCGGGACCATGGAAGTCTTGCGGCTCATTCACGATAA
CGATAACACTTCGCTCAGGGAGCAACTATCACGGGGTGCCGCTCCCTTATTTGCCGGTGGACAAATTGTCGTGGGGCATCGAGTGTATTGCAGCAGAGAC
GCCCAGGAGGTGGCGGTGTTGCACGGCCACAACAACGTCGCGTGGTGGCTATTCCAGCACGTTCCACATGTTAGCTACGATAGGAACAAGGCTTTTCATT
ACGCGGTGACGAACGGAGATATCGCTCTGGCGGAGTGGTTACTGGATCACGGCGCCAGCTTGCCGGTGATGACACCAGGAAACGTGCTCGTGCAGGGGGT
GGCAGCTCAAGATCGCCTTGATGTGCTGAAGTGGCTGGAGAAAAATCTAGTTAGAGACACTGATGGTGCCTTATTGACGGCGGTCGAATTCTCTGTCCCT
CGCGCACAAGTTTCTGACCGCTGAACATGAGCATGGCGTCGCTGAAGACCCGCCAGAAGCTGGTTGCAACCTTATTATGGTGGTTGCCGCCCCTCCCCAC
TTTCTTCTTCTCCAGCTTTGCCATGGCTGCGCGGAACTCCTGCGAGTTCTCCCACGGGTTGTCCGGACATCCGAAGATTTCGCCCCACGTCACCATGGGC
TTCGTAGCGACAACGCCCCCACTCGCCAATTCCCCGTCGTGAGGCCTCCATTCGGTGCCCACCTGGAACGGTAGCAGGTAGTCCGATAGCTGGGACGCGA
AGGCTGCGTTGTCGACCGCTGGAAGGAAGTCAAAGAGCTCCAGCGCTTCTCGGATCCGTTGGAGTGAGTCTCTTTCACTGAGGAGTCTTGCATCGGTGGG
AAAGTTTACGCGCATGTGTCGGGGGTGACGAACTTCTGCTCATCGGGCAGTGCGTCGGGTCAACATTGAAAGGAGGCGCGGATGTGTCCCGCGTCGTGGG
CAGTCTCAGGGATCTGGAGGACAGACTGAAGGGATTCCCGCCACTGCTGCAGGAATGCCCACTTGGTCTCCATCTTGGGGGGGGGTCTTGAGAATTACTT
GAGCGGAAGGTGGCCAAGTCAGAAGTGAGCACAATGCGAGTGTCTCTTGCATCGACCTCGCCGCTCTTCGTCGGTTTTGATGACTCTAGTTGATGACACG
GTGTACCTCCAGTTGCACTGCCCCCGAGTTGCACATGTTGTGCTGATAGTTGGGATGGTAGCACACTCCAATTGGGAAAATGACCAAACTAGTATTAGGG
AACGGATCGCCAAGCAGAACATACCAACAAGGCTCCCCAAAGTAATGGTGCGACCTTCACCAGGCAATGAAGAAGAGGTTCCCCTGCGCAAAGACCACGC
CCAGCCTCTCCTCGCTATCCTCATAATTCTCATCGGGATAGTGTTCATCCAGCCAGTCGTTGATGTTATCGGTGGGCCAGTCGATGACTCGTTTGCGCAT
GCCCTTAAAAAGTGGGTGTTTACACGTCTCCGAAAATGCTTCACCCCTGCAGCCTTCAGTGCGTTGCGAGTGCAAGAATAGAATGCGATCGAAGTCTCCA
TCCGACGCTGCGCGATCAAGCGCCTTGGTCGTGCACCCCTCGACTCGATTAGCCTGTAGCCACTGCACGATCTCCAACGTTTTGGCGTCGTCCATAGCTG
CACTGGTGCAGCCTTCCGAGCGATTCATGTGGAGCCACTTGATGATGTCCAGCTTGCCATTGCGAGCGGCTCCATCCATCGCAGCGACCGTGCAGCCCTC
GGTGCGGTTTTCATGCAGCCACTTGACGACTTCTAGGTGGCCCTTGGCAGCAGCGGCGTCCATGGCTTTCGCCGTGCACTGAGCCTTGACCTGTCCATGG
AGGTACTTAACGACGTCGAGGTGTCCATTTTGAGCCGCTCCATAGAGAGCTTTGACCGTGCATCCTTCGGGTCGATTGTGATGCAGCCACGCCACGACTT
CCAGGTGGCCACCACTTGCAGCGTTGTGTCGTGCATCCCTCTGACCGATGACGGTGCAGCCACTTGACGACTTCCAGGTGTCCTCTCCCCGCTGCGGCAT
CCATAGCGGCAACCGTGCACCCCTCGTACCGGTGCGTACCGAGCCACTCCACCATCTCCAAGTGTCCGTTCTTCGCCGCGAGGTCCATGGCACTCTTTGT
GCAGCCTTCAGTCCGCTTGGAGTGTAGCCACTTGACGACATCGAGGTGGTTGCGAGCAGCGGCTTGGTTCATTGCTCGAGATGTGCACGTTAACCCGCAT
TTGCGCGAAGCTCTCGCTTTCTTCTTCGGTTGACGGCTGGTTGAGGCGTTCGCTGCGACCATGATCTTGTGAAGGTACTTGAGCAGTGGGAGGTCTCCAC
GTCGAGCTGCCGTGTTGAGGCTAAGCACCTTCTTCCCCCACTCGGTGAGCGAGCTGGCCTCAAAGAGGTCGATCTCTGAGCTGAAGGTGACGACGAGCCA
TTGCACGAACTCCAAACTCCCCTCGTCGATCGCTGAAGTCATCACAGCCGAGCAGATCCAAAGAGGGTTATTGTCACTTTTCGAGAACGAGCTCTGCGCT
GGATAATAGTGCGACGCTGTGATCTTCCCCCAGTACTCAGTGTACAGTTCTTTCGACATCTCAAGGTTGCACGCCGCCGCTGACGACTGCAACGCTCGAC
CTGCCTCCACCAGCTTATTGTCGATCAGAAGCTTGACAATATCCAAACGGTCTGCGTCGACCGCAGGACCCAGTGCCAGGTAGTTCCAGCTGCTCTCGTA
GCCGTTCGTGATCATCCACTGCATGACCTCAAGCTGCCCAGCAGCTGCGGCCTCCTGCATGAAGATCTCGGGGTCTCCTCGCAGTAGCTCGCCCACGTTC
TCCCCCGAGAGGTCCCCCGGCCTCCCATTCCAGCTCGGACGAGACGGCTCCACGAATCGAATTGCGTCTCGTTCCTCCAGCTCGTACTCCTCCGTCTCCG
TATCAGGGTCGAACCCCCGAGTGGGATATTTCTCTCGAAGCCACTCAAGGAGATTAATGTCCCCGTGCTTCACTACCGTCATGAGCGTGCTCTTCATGGC
TCGAGGCGCGCAAGTGTTCTGGTAGAGCCACGTAATGGTCTCGTACTGCTTATTGGCAGCGGCGTGCTCCATATCGTGACGCCCCCAACGGACGACGTGG
CCCTTGTCGTTCTCGATCTCGTCCCTCATGGCTGCGCCTCCGTCCCTCCTCCCAGGGATCTCAATCGCCTTGAAGAACTTCAAGACGTCCAGGTTCCCTT
TGCCCGCAGCTGTGTGGACGGCGGTGACGGGGACGATGCAGCCGTGGAACTTGGTGCAGAGCCACTGCACCATCCGCAGCGCGGCCTTGGCGTCCTCGAT
CTTGACAGCTTCCACGATGGCGCGACGCAACTGGAAGCGGCGGTAGTGGCGGTCCGTGCGCAGATACTTGCGTCGGGTCCACGAGCCCCCGTTGCCCGGA
CCCACTTCCGCTGGAGACGGGTGCGTTTCCGGTAGCGAAGAGTCCCAGATGCGGTCCAGCAGGCGGAGGGAGTTGAACGTGCAGGCCTTGCACAGTTCCA
TCTCCACTGCAGCGTCCAGGAAGGCCGTAGGGCGGCGGAGGCGTGGATGCAGCGCGAACGGAACACCAGCGTCACGGCCGTGAGAGGGTCCGGGGTCGGC
AGCCTCGCCATCTTCTTCTTCGTCTTCGTCTTCTTCTTCGTCTTCTGGACGTGAAAGGCACGCGGCGAGTTGCGGAATGAGTGGGAGTTGGCATGGCGCG
CGGCCAGCAACTTCAAGACTGATTGATGACCCCAGATTCTCACACGTCACAGATTCGATTTTGGGTGGTCAACATTAAATTTGGATGACTTGTGTGCAAT
TTTCCGGCGTAATGATGAATTACGGCGAATATTCTCTAGAAAGTAAAAACAACTTTGACCATGTTACACCATGATAGCTAGCATCCCCCCCAGTCATAAT
TGTTTGAGGAGCATGACATACCTAAAACTGACAACGGCCGAGACGGAATGGAAGGGCGGTTTGCGTCTCTCGTTTCGCAGTCTGTCGCTTCTTGATCGAC
GGAGAAGTTGACAGTAGCGAGTGTCGTTGAGTTCAGGACGACCAGCCGGACGAAAGGCTAATTGAGAGCTGGCACAACTCGACAAGAGTGAGCGGAAGTC
GGGTAGGGTGCTCTCTGATGGAATTAGATAAACGAGTGGTTTCATTGCTTGAGCATGTTTGTTCCTCATCAGTAAATTTAACTCGTGATGCGTGCAATTC
CTCGCACGGCCCCATCAATAAAGCCCACGCGCCGCAACTCTAAGTCCATTCCTAACGCTGTCGATACCTCTTGAGCATTCATAAGTCGTGCTGGTGTTGG
AGATGGCACTGGGTACTTGGATGAAGTACATTAAAGTATGATTCATTCAGTGCGAAGATCGTACGAAATTCTTTTTTCTGGGCCATCGTCCAGTTGCTGA
AGTCAAGCTATACATACATGTAGCGACGATGGTCCGCCTACTTTGAAGGGTCTTGCCAAGAGCTGGATGGCATGGCATGACACGATGCAACCGGGCGTCG
TGCCTCCGTTGCTCGTCGTGGAGCTGCTCTTCCGTGCCAAAAGCGACTTCACCGACCTGCCACACGCCACCACATCCGTCTCACAATTCCTGGACTCGTC
GGTCGAGTTGCCGCTGCACAAGGCCTGCGCCTTCGAGTCTCTGCGGCTGCTGGACCGCATCTGGACCTCCTCCAGAGCCTACAAAAAGAATTCTGTCCGT
GACGGCGCCAGCTTTTCTCTCGGCCGTTGCCTCGGGACCGACCGCTACTATCGCCATCACCAGTTCAACCGGTCCCTGCTAGAGGCAGTGAAGCGGAGGC
ATCTAGCGATGGTCATGTGGCTGTCCTCCAAACTCAAGGGCTACCTCATCGAGGGTGAAGTGGTGACCGCAGCGGCCAGCGTGGGGGCCATCGAAATCTT
GGACTTCTTCCGTTCGAACGACAATACGTCGTTCATGCAGCGACTGACATGACAATACAAGGTGTTGTGGGACATCGAGTCTGCTGGGGCCCTGATGCGC
TGGAGGTGGCCGTACTGCATGGCCACAGTAACGTCATGTGGTGGCTACTGCAGCACACACCGGACAATGGATACGACATGGATAAGGCGCTTCACTACGC
CGTGAAGAACGGAGACATTGCTCTAACAGAGTGGCTGACGTCTCATGGTGGTGCTGACAGTCCGAAGGACACAATATAGTGCACGAGGTGGCAGCTCAAG
GGCGTCTTGATGTGCTCAAGTGGATGCAGAAGAAGCGAGGCGTGGTGACAAATAATCCTGGGGTTTTGCTGATGGCGGCGGAGAGAGGACACTGGAAATG
GTGCGCTGGCTGCAGGATTTGGACGCGGGAAGCAATGGCAGTCACATCACCGATCTGGGTGAGGCGAGTCTTGCTATTCACGTTGCGGCGGTGAATGGGC
ATCTACAAGTAGCAAGATATCTTTGGGCGCGGGCACTGGCACCTGTGGCGCTCTTCAACGCGAAGAAGCACGGTTGGAACAGGCGATTCAGTTACGACGT
TTGACCGAGGCACTCGGTGGATCGTGCACGGCTGCCAAGGTCACCATCGACACTGTGGTCGAAGCCGGAAAGAATGGCCATGCGGATGTCGTGCAATGGC
TCTTGGCGGAGTACCCAAAACTGAATTTCGGCGATCAACAGACACCCACCGATGAAACCCCGATGGATGCTATTGCTGCGCGTGGGCATCTCAACGTACT
AGTGGTAGTGCAGACGATGAACGTTAACGCAGATAGTCGGAAGCGCAACAGGGATGGATCGCGTAAAGGAGGTCACGTTTGCACGAGTAAAGCTATGGAT
GACGCTGCGGCTAATGGGCACTTGGATGTGGTAAAGTGGCTTCATGAAAATCGAGACGAAGGATGCACAAGTCGCGCAATGGATGGTGCTGCAATAGGAG
GCCATCTACGTGTGATCCAGTGGCTACACGAAAACACGTCGCAAGGATGCACGACCGGCGCTATGGACGGAGCTGCTGTCTATGGCTATCTCGACGTTGT
GAAATGGCTGCACTTCACTACGAACGGCGATGGACGGAGCGGCAGCAAGTGGACACCTTCATGTCGTCCAATGGTTGCATGAACATCGCGGCGAAGGATG
CACCGTCATTGCGATGGACGGAGCAGCAGCGAATGGGAATTTGGCGGTTGTGAAATGGCTGCACAGGAATTAGTCTGAAGGCTGCACGACTTTGGCGATG
GACTTTGGCCCGCTTCATGTCGTGCAATGGCTCCACACTCATCTCTCGGAAGGCTACTCAAGCGATGCTATAAACAGTGCCGTACTTCGTAGGGATTGGG
AGTTGCTGCTGTTTTTCCACTCTCAATGCAAGCAAGTTTGCACGGCGGAGACAGTGGAATTGGCTCGCAACACTGGTGACGGTGAAATAGGGATTTATTG
CTGGTTTGTCGCCAACTAACCACAATTTCGGCCGACTCCGCGGGAATAGCGCAGCCCTATGGAGGATGTTTCGTGGGCTTATGTGAAAGCTCACGTAAAT
GTGGCACTCGTGACAATTTCCAGGGCAAAAGTGAAGTAGACAATAAATGTTGAATCGACACGCGATTTTTTTATTGAGCTTGATACCGTACCTTACTACT
TTTATAACGTACGAGTAACG