Description :
From Genome Similarity Track
Location :
Scaffold_6:1392391- 1393718
Transcript NameFunction/comments
Physo_548628pectate lyase

Sequence
1327 bases(100 bases per row)
GCCCACACCAAAGTTCTGGCTGGTGGTGCCGAACTTCTTGGCGGACGTGGGCTTGTAGTAGCTGGCCACCTTCTTGGAGTTGGCCAGAGCCGCCGACTCG
CGGTAGCCCGTCAGCGTACCGCAGTTGGACACGACGTTCTCGACGCAGTTGCGGCCCAGCGCGTTCTTGCACGCCGACTGCATGGTCGAGGACGGCGCGA
TGATGGCGCCCACAGTCTCGGCGTCGTGCTTGTTAGGGATGGCCGTGTTCTCGAAGTAGGTGCCCTCCAGCAGCACGTTGCCGTTCTGCAGCACGTCGTA
TGAGAAGCCCGTGTTGTTGACCCAGTAGTTGTTGACAGCGTGGACGATCGAGTTCTCGGCGACCTTGGGCGAGCGGCCCGACGTGTTGTGCACGTAGTTG
TTGACGAGGGTCACCTGCGTCTGCGTGCCCAGGAAGAGGAAGGTCCAGTAGTGGTTGCCGTCGCACGTGGCCGAGTACTGCGTGCGGCCGTCGAACTCGG
AGTTGCTGATGGTCATGCTCTTTACACTGGCCGAGCCCGTGGCGATCATCTGGCGGCCGAGGTTGGAGATCTTAACGTGGTCGATCCAAACGCGCTCCAT
GGGGGTCTTGCCGCCGTTGAGGCCCTGGATGTAGATAGCGTCGCCGCCCCAGATGAGGTGCGCGTTGAGCTGCGTGATGTGAATGTTCTGGATGATGATG
TTGTTGCCGCGGAGCCACAGACCCTTGCCCTTGATCACTCCGTTCGTTCCGAGGCCGCGCAGGGTCTTGTTGTCCGAGACGATGAGCGGGTTCTTGGTGG
CCGCGATGTCGTACGTGATCTTGACGGACGTGCCCTGCACGCAGCCGCCCGTGTTAGCGAAGCCGCCGCTCTGCAGGATGACGTCCTGGCCCTTGTAGCC
GTTGTTCTTGGCGAGGCAGTCGCGGTGGCTCTTGGGACGGCAGCCCGTCTCGGTCTTCGTGCCCTCCGAGCCGCGGAAGTCGAAGGTCTTGGTGAGCACG
ATGACGCGCGGCTGCGAGTCCTGGAGGTAGTTCCTCAGGTCGTTGAGCGACGCGGGGTACACGGGGGCGATGTTGCCACCGCCGGTGGTGCCGGCAGCGA
GGCCCGGGGCAGAGCCCGTGGAGATTGAGCTCTTGGTGGTGACACCCTGTTTCGTAGACGTCTGGGCGACATCCGAGTTCTGCAGCGCCGTCGTGCTAGA
ACCGGCGTGCGCGCCCTGCATGGCGAACGCGGCAACGGCAACGATAACGAGGCGGAAGATCTGCATTGCTGGCTGTTGCGCGGTGTTGGTTGGAGACTTG
TGCTGCGCGAAACGAAATCGATAATGA