Description :
From Genome Similarity Track
Location :
Scaffold_1:139229- 140305
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1-fgenesh-gene-1.6Myosin

Sequence
1076 bases(100 bases per row)
AACCAGTCGATTCTAGTGAGCGGTGAGAGCGGATCAGGAAAGACCGAATCGACCAAGTTCCTGATGCAGTTCCTCACCTCGGTCGGCAGTGACGCGTCTG
CCAGCGAACACTCGGCGGGCGAGGTCGTGGAGATTGGACGACGGATTTTGCAGACGAACCCGATCCTCGAGTCTTTCGGAAACGCGCAGACGATCCGTAA
CGACAACAGTTCGCGCTTTGGTAAATTCATCAAGATCCAGTTCAGCCACAAAAATGACATCGTCGGCGCGGAGATCGCGTCATACCTTTTGGAGAAAGTC
CGCCTGATTCATCAGTCCCCAGGCGAACGTAACTTCCACATTTTCTATGAGCTGCTTGAAGGTGCCGATGAAGCTCAGCTGAGCGCGCTCGGTTTGAAGC
GTGGCGCGAAATACGAGCTGCTGAATGCCTACGGTGGTCCGATGAATCGACGATCAGCCATTGGCGCGAACCAGTTTGCGCAGCGATTTGCACAAACGGT
CCAGGCTTTTGAAGACACAGGGATTGACAGCGAGGAGCAGAACCTGATTTACCGGATACTGGCCGCGCTGCTGCATTTGGGGAACGTGAATTTTATGATG
GAGATCCACGAAGGAAAAGGTGAATCCGGCACGCGAGAGGAGTCAGCGGCAGTGACAGCAGCGACACGGTATCACTTTGAGAAATGCGCGGAGCTGCTTG
GTGTAACGACGAAGGATCTTGACTCGTTGCTGCTGACCAGAAAGATCACGGCAGGTTCTGAAGTGATGGTGTTGAAGCAGAACGCGGAGCAGGCAAAGGA
TATCTGTCGATCGTTGGCGAAGGCAATCTACGGACGCGTGTTTTCCTGGTTAGTGCGGAGACTAAGTGACGGGATCAACTACTGCGACAACTCGGACGTG
TACGACTACGACGCGCCTGAAATCAAGACCATCGGCATTCTCGATATCTTCGGTTTCGAGAGCCTTGGTCGCAATGGCTTCGAGCAGCTTTGCATCAACT
ACGCGAATGAGAGATTACAAGCGCAGTTCAACGAATTCGTGTTCATCAAGGAGCAGGACGTGTACGTTTCGGAAGG