Description :
From Genome Similarity Track
Location :
Scaffold_104:13920- 15476
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_104-fgenesh-gene-0.2Maintenance of ploidy protein mob1
Pytir_DAOMBR486maker-pir_contig_104-snap-gene-0.23Conserved gene of unknown function

Sequence
1556 bases(100 bases per row)
AGGCGGGATGAAAGCGTACACTAGCAAATATTGCAGTCAAATAGAGAATATAGTTATTTAACGTACTTTGATGATCTACTATTACAATAAAAGCATCATT
ATGTACTTCAAACTAATTTTCAGGTAATTCTAAGATCGAATATGTAAATAATGGCTCTTAGTTGAAGTTGCAACCGAACGTGGCGCCCCCAAATGTGGAT
TCACACACTCATTTGCTCAAAATAGACGCGATCATCGGCGCCAATGGGCTCAGAAGGTGCACGATGTCACATCCGCTCGTGGAGCAAGTGTGCTGCCGGA
CAACGACAAAGCGCTACTACTGCCAGCCAGGAAGGAACCCATCGAAGGGCGACGCAGAGCGAGATGAACAACCTGTTCAACCGCAACAAGACCTTCCGCC
CCAAGAAGAACCACAACCACGGCACAAAGCGCTACGATTTGCACAAGCGCGCGCAGGCCACGCTTGGAAAGTATGGATGTTCACTTCATGAAACTTTCTG
TGAACGCTGCTGTGGATCTGACGTAATGTCTTTGTGTTATGTGAATGACATGCGCTCCTCGTCTCTGCAGTGGCGATATGCGGAACGCCGTCGCGGTGCC
CGAGGGAGAGGACCCAAACGAGTGGCTCGCAGTCCACAGTACGTAGTCAGCACCCTGGTCAAGAAAGAGGAAAGCGACCCTAACGATGGCATTTATTAAA
CTTGCTTACTGTTCTAGCGATGGACTTCTTCAACGAGATTAGCATAATCTACGGCACGATCATTGAGTTCTGCACGGCTGAGTGCTGTCCGCAGATGAGC
GCCGGACCAAAGTATGCTTGTTGCTTTCGTTTCCCCCATTGAGAATGCGCTCATGAGTCTAACTATTGATATTTTGGTGCACAGGTTTGAATACCTGTGG
AAGGATAACCTCAAGTACAAGACACCCATGAAACTCGCGGCGCCAGAGTACATTGACATGCTCATGGCGTGGGCTGAAGACTTGCTCACCGACGACACGC
TCTTCCCGACTCGCGAAGGTGCGACCTACTGTCGCGGCTTTGTCGCGGTCGTGAAAAACATCTTCCGGCGCCTCTTCCGCGTCTATGCGCACGTCTACTA
CTCACACTTTGACAAGATCGTGAGTCTTGGCGCCGAGGCGCACCTGAACTCGTGCTTCAAGCACTTCATGGCGTTCGTGACGGAGTTCGACCTCGTGGAC
AAGCGAGAGCAGGAACCGCTCAAGGACCTCATCAAGAACCTCATTGGGTAGATATTAGTAAGACTATTAAGACTGACAAGGGCTTTCAAGAATTAAACGA
CCAATTTCAACCATAACTAAAGTGCAGACTCATCTCGAAAGGTAGCAGGCGCTGGGATCTCTCTATTCAAACGCATAAACATCTAAAGCGGCCATTTGGC
CATCGATTTCTGTGGCTAGTAGACTTAGAAAAGCAAGTCAATGGGCTGCTGGAATTGCTGCGTCTGCTGTTGGTACTGCGCTGGTGGCGGTGGCTGAGCT
GTCGACTGGTACATTGGGTCGAACGGATCAAACGACGCATAGTTGGTAGGGATGGC