Description :
From Genome Similarity Track
Location :
Scaffold_310:1392- 2991
Transcript NameFunction/comments
Phyta_totarag6967hypothetical protein
Phyta_totarag6968mitochondrial 2-oxoglutarate/malate carrier protein, putative

Sequence
1599 bases(100 bases per row)
GATATGTAAGAGAGCTGCTTGAGGCATCGTTGGTGAGCTTACGAGAGCGAGGGCAACCAATTCTGGATATGTTTAATACTACGACTTGATTCCTATGGTT
GTATTCGGCATGGTTAAACCCCAGaagagctcgtcgtcgggtGAGGTAATCGGTCAGTCTCCGTGAGCTTGTTGACGCGCTTACTGGTTCTCGCTACTTT
GCTACGACTTCCGAGTATCTCCATTTCACCGGCACTATCAGCCCCATAGTCTTTTCGAATCTAACGGAAAACTTCCTCTGTGTTTTGTGTGTCTACGCTC
GTTCTGAGCCGCGAGTACACTACTGCTTGTAGCCGTGCAGCATCGCTCAGAGCTCTCCGCCGCGAGATCACTCCAGTACCCCCCCCGCGTTTGCTTCATC
ATGCTCGCGGTCATGACTTTATCGCTCACCACATTAAATCTTGTCGTTCTCCTGGTCCAGCGCTGTATTACGCTCACGTAGCTGACGAATGTCTACTTTC
AGTCGCTTGAGGTGCTCGACCACACTCTTGCTTCGCCAGCATCCCTCGGCGGCCACTTCGACGGGTTCTGCACCTTGGGGAAcgtctcgtcctccttctc
agcGTGGTGCTCGTTGGCAGCGAGCACCATGCGAGTCACTTGACACGACGTAACTCGTCGTGCAACGGTGTGGCCTTGACCTGTTTGCTGCATGGCAAAT
TTTGACAGTGGGGAATTGTCTGCTTGACCACATTCTTCAGTTATAGGGCAGCGCCACTTCCGCGACTCTGTCCGTTTGAAGGCAAGCTGACTTGTTTGGA
GGGGTTAGAGGCTCATGAGAGAAAGCCTTGAGCTATCCAAATCCTAGTTACACTTGTACAATATTGACACTTTCgatgcacttcaacaccCGATGTCAAA
CATTTGTGTGGTCGCGGTTCGTCCCATCACGTTGATGATGCGGCAAtccattttcagccaatcctTTCATTGTCTACACTCTTTGAGCCAATAGGCATCG
CACATATCTCTTCGTCGACAATTAATAATCACACAATACAATAACTGCGCGCTCAAAAGCAGTTGAGAACGCAACGGTCGCAGTGCGGCTCACAATGTCC
ACCGACTGTAGCAATGTGAAGCCGCGGCCTCCCTTGGCCAGCTACATGTTCGGCGGTCTGTCAGCAGTGGGCGCCGTGTTCTTCACGCACCCGTTCGACC
TGCTGAAGATTCACCTGCAGacgtccaagaaggagaaTCTGGGGCTAGTCTCGACTGTGCGGCGGATCCTCAAGCAGCAGGGACTACGTGGACTCTACCA
GGGCATCTCCGGTGGAGCCATGAGAGAGGGCACGTACTCTACCACGCGCTTCGCAATCTACCACTACctcaaggacgaggtggtgcgTCGCAATGACGGT
CAACCCATCTCCACGGCGCACAATGTGCTGCTCGGGATGACCGGCGGAGTCATCGGAGGCGCCATGGGCAACCCGGCAGACATTGTGAACATCCGCATGC
AGGCGGACAGTCGGTTGCCCCCTGAGAAGAGACGCAACTACAAACACGCAGTGGACGGTTTGATCCGtgtcgagaaggaggaaggtCTGGCTGCGTTGA