Description :
From Genome Similarity Track
Location :
scaffold_1181:1392- 2629
Sequence
1237 bases(100 bases per row)
ATGAACTAAGTATACCTTCTATCACGCCATCACAGGAGCCATCATAGGAAACAGCTCCTGTTTGCTCTGCACTCAACGGCCGTTGTGATTACGCGTGTGT
TTTGATCGTAGGACACAAGTAAACATGTACTTGAGGACTGGTATTATAGGATTGTATAAAGCTTAGCGAAGGTGATGCGAGTAAACTCCATCAAAGTTGA
CTTCGTCTCGTCTTTACTATTGACGAACGAGTTGATAACACCTAGAAATGCAGTGTTGTAATTGGTCGAAAATGAATATTCGACAGCGACAAATATGGTA
AAGAGCATATATAAGAGCAAATTTGCGCCACATCCAACGATGTATTTAGTACGAACCAAGATCCCTCGAGGCAACAAGTGATTGGCAATCACGAACGTCC
ACAACGACTCATTCTCAAACCTAAGCTAACCCCACTAATGGATGCTTCCGCCCCCAATTCCGTCACATATGCTGCTTGTAGATGCCACAATGTAGTAATT
GACCACGTAAAAGAGAAGGTGGGCATATTCAGCACACGCGACAGCTCGGACGCCTGCTTGAGACGCTTGAGAATGGAGTAAGTCTCGCCATCTTCATCTT
CTGAAGACTTGGTGTCGAAAATCAGCGCACACGTGACCACCATCTTCAGGTACTGCGTCGTGCCTAAATCCTCGGAACCGAGCGAGTCAACAGTGACTTG
TCGGTCACATAGGTCGCCCACTGTACTTCAATTTTGTGCGACTAGCTCTGCTAAGATAATGGCAATGATAATCGAGATGCCTTCAACACGGCACAATTGC
TGTATGTGCGAGGCCTGCGACTCCGTGCGTGAAGGCAAGTAGAAGTTCATAATCTTGCACTCGTTGAGTGTATTGTCGAGTAACAATTTTCTGGGTGCCA
ATGGCGTTTAACTCGAAACTACAGCAAGTTTACAAGCTCATCCCAACATGGCGATACATATCGGGACTAAATAGCATGACTTCAAAATCCTCCAGTACGA
GTTCCAATTGCTGCGGCCGAATGCCTTGCAATTTTTTCCTACACTTACACAAGATATACTGGCTGTGGTAGTTATTAAGCTCTTCATCAGCGTCATCCTG
CTTGCCCAGTTCCTCGTGGTTGGTCGCCCAACACCGGGTTGTACCTCTCGATCGACATATCGCAGACTTCCTTCATCGTGAACCTTCTCAATGCCAATTT
GGGCAACACTGCCACAAATAAAATACCATTATTTAAT