Description :
From Genome Similarity Track
Location :
scaffold_48:139144- 159113
Transcript NameFunction/comments
Plaha_PHALS_02264hypothetical protein
Plaha_PHALS_02265glycoside-pentoside-hexuronide :cation symporter family
Plaha_PHALS_02266hypothetical protein
Plaha_PHALS_02267hypothetical protein
Plaha_PHALS_02268arf guanine-nucleotide exchange factor gnom-like
Plaha_PHALS_02269Predicted ATPase (PP-loop superfamily)
Plaha_PHALS_02270Polyadenylation factor I complex%2C subunit FIP1
Plaha_PHALS_0227160s ribosomal protein l21-1

Sequence
19969 bases(100 bases per row)
GATGGTCAGTGTAACTATGACAAAGAATACGGCTCACAAAAGGAGAAGAGACCAGAACGGAACTCACTCCGTTCACCAAGTAGAGAATAAACTATCATCA
TCCCATCAGGCACGACACTACCAGGTTACTTGCAAAATCGAAAATGGACTGTGTGGCTGACAACGCATCCTCAAGCTGGTGTCAGGTACCCAAAATATAT
TGTCGTCAATTATTGACATACAAGTACCAAGTCTAAGTGAATACCGGTAGAGTACAGTATGTAATTTGGCACTTTTCACCAATCATGCTTGACACTCATC
GAATGTGTCATGGCTGAAGATCGGCTTCACGAATTGGATGTCAACGTGTCTGTCGAGACCAATCTAAGCACCAAAGACCGCAAGAAATATGAACAATATC
AAAATATAGCGCTATGCGAAAAAACACGCCTGATTGCGATTGCAAATGGCCGTTTCGTCGATTTGTACAGGATCGATACCAACGCGATCCATCCCTTTCC
ATTCCTCCAACAAATTTCGATCTCTACGTATATTAATCACGTCTGTGCTTCGATATTCACCAACTTGAATGATACAGATCCAAaactcgtgaaagcgact
TGTGTTGCTTTTCCCGTTCCGAGTTTTCTTTTAGTTGGAATCTCCGTTCGAGTTCCAGAATCTGAAATGTCGAAGTGTGAAATTGTAGAAACTAAGACTT
TAGTGCTCGGATTACGATTGTATGCAACTTCAGTGACACcatttccgtgtggcaagtttgtTGATAAGTCTCAATATCATGAACCTTCTGTTCAAGTGTC
GTTCAGCTTTGTAGAAAATGTTTTGGGGACATTTGACAAGGAGATTCAGCATTTCTGCAATTTTCGACGTGATATGACACCTGATGCTGGTTCTGTATTG
ATTCTTTTGGAGGATTCAAATCAATTTGGAGTTCTGAGCTGGAAAGAACGATTTAGTGATCGACAAGTTTGCATGGCACAAGTCAAGCAGCAAGCTGAAA
ATTTGATAAGTGCTGAATGCGATCATAACGGTCAATATGTTGTGCTTGGAGGCGAACGTGGACGACTTTTTCTAATGAGTTTCAGACACTTTATGCTTCA
TGAAAGTGACGTGGTTCTTACCCATAAACAAAACGCGGGTCAGCGACTGGTCCTTGGGCCGTGTTCCCGCTCCGGGGTGATTGTACGAGATAATCCTTTG
GAACTAGTCCGGATGGTTCGTACTTTATCATTGACCGGAGTGAACTGTGCAAGTACAAGCCTTCGATGGTGGAGCTTGGAAATTCGAGGTCAACATAAGC
AGCTTCTTCTTGCTGGTCAGCAAGACGGATCATTACGTGTACGTGCTTGGGTAGCTTTATTTCGAGCTAGTAGTACTCTGACAGATATTTTTCAATTGAC
AGATCTTGGAGCTCattcatgaagatgaagagttTCAATGCATTCTTGACATGCGATGCATTCGGGTACGTCGCAATGGGCGGCTATATAATTCCTCGCT
TTTAACTTTGCTATTGCTTGCATAGATATATCCAGGCTTATCGTCAGGCACGCATGATGCTGTTCGAAGCATTTCAATGCCAAAACTGTGTCATGAAAAG
GATTCGAAAATTGTCAAGTTCGTGGTTATCTCCGACATGCGCTGGAGGAATTGGCGAGTAAAGATTACCGAAACTGGCGCCGAATCATCATGCCCAATAT
GGCCTTCAGTCAGAGAATCACTAGAATTCCAGTCAATTCCGGTGCGTTTGAGTTCGTATGGTCGTCTCGATAAGCAATTTCGATACTCGTAATCTCATCT
TTTCATTCGTATAGCTTCAAATCCAAGACGCAAAGAGCATTATTTGGCTTTCAAATTCGGCACAtacatcaaaattgttttcTAAAGCTCTTGCAAGCTC
GACTCCGGACTACACCTATCAAAACCCGATCATCTTGATCATGACAATTAATCGCCTACAAGTGGTTGGCCTATTGAGAGAAACTGTAGCTGAGAATGAA
AAAGCTGTCTCATCAGAGACAGACGTTGGCGAGGAAGATGTGGGTGCTACTAGCGAATACAAGGAAGAGCCAGGAAAGTTACCAATACCGAAAGTAAACA
ACAATGAAGAGAGCGCTTCCAATGGTCCTACAACCATCCAAGACAAGTACAAGCTTCCTCCGATGCTATGGAAAGCCAAGACGTCTACTACACCTGATAG
TTTCGCCTTCGACAAGAACAAAGATTCGAAGATGAGTGGCTCAGAAGATGTCTCTATCTCAAAGGTCAGTCGCGAAGAGCAAACTGAGCGCATTAAATCT
GTTATTCAACGCGTTGAGACTTTAGATAGCATCTTACGTTCAATGCGAACGTCTTTCCAGCTATTTTCTTTTGATGTTCAGCGCCACATGAATTTCGTTT
CAGAACAACTCGAAGACGTGAGTCGTCGACAAGTCACTAAAGAAACTGCCACGACATCAACACCATAAATGGAGAAAAGTTTTCTGCAAGAACAAGCTGA
GCTGGCTCGCTTTGATGCAGGAGAACAACCTCAACACCGTCGCAATGAGACAGCATCACCGATAATTCCACACGTCGCTGAAAAGTACGATCCGGATCAT
CCTGATGCAGACTGGGCAGGTTTTGTGCGTCGTTCGTATAAGAAGCGCTTTTACACAAATCAATCTACTGGCAAAGATGTACGATTATTTTAAAGATTCT
CGTTTAATGCGTCAAAGACATTTACTGTTGTCTATGTAGAGCCTAATATATGACGAGAAAGGTGGTCTCATCCCACGCATTGCTGAACGATCGACGATCT
CAGGAAAAAAGATATTTGAGCGTCAGCTACATCCGTCAAATGAGCATTTGATATCTGATCGTGACAGTAATTGCTCGGACTGGAAAACGTAAGGCGTCAT
TTACTTAGACGTTTGTAGTATGGACATTGACTGGTACCTGTCTATTTGCAGATCATACACTTCTCAAACATCAATGGAAGCAACGGCCAAGGACGATTTT
GTGCTTGGCACGCGGCAAAATCTACAACATAAACGTCATGTGATGCCAATGGTATGTAAGTTCGTTAGATTTGAGTTATATGGCCTCAATTAAATATTGC
CAAACAGTATGAACAAGATGCTCGCAATCAGTTGTCGGAGAACAATCGTCAAGGATCTCCATCACTTCATGATAGTGGGAGCTCGGGATTGCTCTCTGAA
CGTCGGATTGACCCTCGCCGGTCTATTCTCGCTGGCATCGGCAAGCTTGTAGCAGCTGAGGACTTAAACGGCATTAAACCGTAAGAAGCTATTGAAAGAT
TGATCATCACGTGCGTATATCTTACTACATAGTGTGCATGTAGGCCACCGGCACGTCATTTATCAGAAAGCTATAGAAATTCATCATCCAAGACACTTTT
ACCGGAGAACTAGTGagtaaattgtatttcttgtGATGGTTTAAGCTTCGTGAATATTTTATCTGTGGTGTTCATCCAGCCACGCGACAACTATCGGGTA
CACTGGACGTCGAAACATCCTATAAATGCAATCAGAACGAGATTTATAGGATGAGAAGTAGTTAAGATGGTAATACTAGCACGATTACATGGAATGCATG
TCGATCCGCAGGGCAAAGAGGCTGATTAAAGCACCTCCGAGTGAGAATGCGCCTCCTACAAATATTGGCAGCGCGTAACCGAATGATGTTTCGACTAGTA
CAGCACCGACCAAGAAATTGACGAGTTGGCCTACACAATTGGCCGAGTTGACAGCGCCAACGTACATGCCAACCTGTGCTGACGATCCAAAGACATGAAC
GATAATTGGCACAATGAGGGCGAAAATTGTGGCCTGAGTGATGGCAGTCAAGACGACAATCGTTATGTCCAAAGCTACGATCTTCGTGAAAGGCATAACC
ATGAGCAAAATTTGTGGAATGCACGCAATTGTGATGACCCAGCGTGCTCCTAGTCGACAGACGATGAATGGCAGTATCCATGAGTACAGGTAGCCAAGTA
CATTAAAGAGAAGGTCAGCGAGACCGCCAGCAATTTGGACACCGTCATTATAGAGTTGCTGATCCTCGGTACAATGATTTGGTCCACACACATCCGCTTC
TGTCGAGTTTCCGCCAAAAACTTCAATCCCAAAGAACTGACCTTTGCTCCCGTTGTATGCAGTGAAGCCGAATTGAATACAGAAAAACACAAGACAGTAA
ATGCTCAATGTGTGAGGAAGTGTCTTCAATCCGAAGAATATCGAAGAGAATGCTTCGTTGATCCGTGTCAGTGTACTAGGAGGGTTTTCACCAGGTCTTA
GTTCCACTTCTTTCACCAAAGCCACTTCTTCATTGGCAAAGATGCATACAGCACATACAGAAGCCAGCATCGTGACAGAGAGCATGCCGAGGAACCAACG
GAGTGTTAAATGGGCTGCACCAAAGACGTAAATGTATCCTGCAACCCAAATAGAGCCTAATGTCGAACTGGCTTGTCCAATGCTAGCTCCAAGAGTCTGT
CGATCACCTGCAAAATCAGAAATGAGGAGAAAAGCGGGAGTCTGAACCACATTGACAGTTATATCCATCCATGTGTAAAAAACGATGGTAAGCCAAGCAG
TGTATGGTCGGTGGTCACCAGAATCGCCTAAGAATTCTCCCAACTCGCGGGTATATCCCATGAGAACCCAACACGCTGCACTTGTGACAGCTCCGTAGAC
TAAAAACGGGCGACGACGTCCCCATTTGCTCACATTTCGATCACTTAGCACACCAATGATTGGCGCAACTAGTATACCGGAAAGCGGACCGATGAGTTGT
GTGAGTTGCACAGCAAAGGGTGGTATCATGGTACCAAGATACGGACCAAGAGCAGCCCATTGAGCTGACCAAGCCATATTGGTGGCCATTCGAGGTAAAG
ACAGCAATACGAGCATCAGGACAGAACACCCGGCAGTGTGTTTACTTTCGTTGGAATCGTTGAGATCAAGATTTGAAAAGGTTGAAAGTCTTGGAGGATG
TTCCAAGAGGCCTAAAGCTACCGACTCACGGTGTGATGCAGACTCGACACGGTTGTACACGGGTGTTGTCACTTCAAGATGAACACTCATATCGTTGGCA
ATTGTTGAAGAGAGGGCAATTTATTGAATGACAGCTTGAAGACGTCGATTTCGACACATTTACAAACACGTTCAAGCTTATCAGGTTTGTTGGTCTCAGA
TATACGCTTTAGTCGTACGTCTTACGTACGTGCTCAGACATTGCAATCTCATTTGAAAGCAGTACTCAAAACCATTAAAGTAACTTCATCAATGCGATCG
ACTGTAAGACAAATTCAATACTCATGTTAGACAAATTAGGCCGTCGTATTTGATTTATTTAAACGCTCGCGAGCGTCTTGTAAAGTCTGTCGCATACGTT
CTTTTGTACGTTCTTTTAAATTTCGAAAAAATGCGATATCATCCTGTAATTCAACAAGAATATCGTGACTCATTCCATGCACTTGTGCTTCGCGGTACGA
TCTTCGTAAATCGTGTAAAATATCCAATACTTCTTTTAAATGACGTGTATCTCGATCTCGTTGTTCGGCTACTTTTTGCCATTCGTGAAGACTCATCTTC
ATTTTACCAAGTCGAATGGACTCCATCAATTGATCTGTGACGACCGTTCGACAATTGCCACACAATTGTCCATCAGCTACGACATTCTGAGTATACGAGT
TGGCAATTCCACTTAAAATTTCCAAATCGGTTGTTGGATTCTCGGCTGTCGAAGTCGCGGATTTGCTTAGATTAGGTACTGGGTACTGCATCGCAAGGAG
GTTTCCTTGACTTCCATCATAAAATCCTTGTAATTCTACTGTAGAGGTTGCTGTCTCTGGTTGGGTTGACATTGTCATGGGTAAATTCCTCTTATTTGTC
ATATTACTGATAATCTGCATCTCGGAGGTGTCTCCAACGCTTTCATTTCCAATTTCCTGCTCACCTCGCTTGGGTAATTGATGTCCACTATTACCAAAAG
AAGATCCTTGAACACTTGAGGCAAGAGTTCCATCGTATTTGCGCAATAAAATAATGTATCCCCCTTTATTGTCATTAGCATTCGGTCCTTTCTTGATGGG
ACGGATGCCACGTCGGTAGCATTCAGCACGCAGATCGTGTGCACGATGGCGTTCATAAGGTTCATGCAGACGACGTACAAATGCTTTTACTCCATCTGGT
AAATCAACGCCTCCGCTGCTACTGTGAACGTCGCTAAGCAATGAGCTTTTGCTTGCGTCCATTTGCTTTGTATAAGTATAAACTTCTTAGATAGAATTTA
TACAATTTCTAAAAAATTTCGATAACTAACTCAATCGGAGTGAATGTAGTACCGACACTCTAAGCTCAACGGCAAGGACGAGCTATATCTGGGCAAAGAC
TGTCAGTGAACGATAGTAAATGGTGTTTGAAGAGCTAAATGGAGCTCTGATCTGATCATATTTAAAAGTATTTCTGTCTCAAATGCCGAACAACCATTTT
TAGAGAATACGCAGATCTACATCTCACACGAGCTACGCGAACGAGGGACTTGTCATGGATCTATCACCAGATTTAACTGCTGAGGTTACACGTCTTAGAC
ATGAAGTGAATGCTAAGGAAGAGGCACTCAATGCGTTGAAAACCAAGACTAAGGCGTTTGTTGACAACATGCGTAGTCAACTTGCAAATGAGACACAGAA
AGCTATCGCGTTGGAAGCGAAGCTGAAAGAAGCCACTGCAGCTTCAAATGCATCAAGTTTAGGATCCGAACAGCAACGTTGGACAGAAGAGATTGAAAGA
TTGAAAAAGGAGACAAATTTACGTGAGAATGACTTGAAATCTCGTGCAAAGTCATATGCAGACGCTATGACGTCACAATTAGAAAGCGAAAAGAAACGAT
GTCGTGAACTGGAGACtttgctgcagcaaaagaCGGAAGCTCTTGATGCTGCTAAAACTATTGCGACTCCAACTAATgagcttgattttttttcacaacC
AGTAATTGCTACTGGGTCACACACGGATGATGAGTTTCATGCCGTGCAGTCACAATTAAGTTCAGCTAATTTTGAAATGGCTGACTTGCGTGAACAGCTT
CGAAATGTTGAAGCGGGTGCTTTGCAATCAACACGACAAGCGGAGAATGCTAGTCATGAACTAGAGACGCTACGTGGGGCCTCAGAACAGCAGTGTCGTG
AGCTACAATCTGAAGTGAACTCTCTGAGAGCTCGTGAAAGTTCATTACAAGCACAACTCCAAGCTACGGAGAGTAGAGTTAATATGGACAAGATATGTGA
ATTGGAACTTAAGATTCAACAGCACAAAACCGAGAATCATAGTCTTCAGAATCAGCTAATCGACAAAGATTTTCAACTAGAGCAGTTGGATAACTACCGA
CGACGGGCAGATGATAGTGAGACTAAGGTGCTTCAACATCAGGCGGAAATTAACGTGCTACAAACCAAGCTATCGTCGTACTCGTGCAATAAATGTAATG
TACTTGAAGAGAAGTTAGCAGAGATTACCCAGCTTTATGAAAAAGTTAATCTTGGTCGAAGTCGCAGTGATAGTTTAATCGCCGAGACGCAGTCGCAATT
AGGAGAACTTCAGACTATAAAGCAGCAATATGTGGCGTCTCAGGATCGAGTGGATGATTTAATGAAGCAGAATCTCAAGCTGAATGAAAAAGTCACGGAA
AAGGAAATTCAAGTAGCGAATCTCAAGGCTGAATTGCAGAAATCGAGCACGGAGTTGGCGGATCTGAAGTCGCAGCACAATGCGCTCATGTCTGACAGTA
CGCAGCACCGTCAACTCTCCGAGTCGATTCACGTTGATTTGCAGAAGGTTGAGGAGACTCGAAACGAATTGCAAGCTAAATGCATCAATCTGGACAAGAA
AAACAAGGAGCTTACGACAGCAATAGAAAGTATTAATAAGGAAAATACTGATAAACGTCAGAAAGCGAAAGCTCTTGTACAGACATTGGTGGGAGAGAAA
ACGAGCTTGCTTGAGGCTAGAAGCCACTTACAGAAAGAAGTTGATCGACTGCGAATGGAAGTGAATCAGCGTAATGTTGACAACGATCAACAACTCAAGA
CACTTCGAGATGAGACCAATGAAAAAGCAGCTGAGAATCTAATCACCATTCAGAGCTTGACGGATGAAGTTGCTAAGTTGAAACGCACTCTTACAACTGT
TCAGGAATCCGAGAAGGTTCAACAACGGGCGAAAGAACTTGCAGCAGCGAAGCGGGAGATCGAAGACTCAAATAAGAAGCGACTTGCCGCAAAGGCAGAG
ACGCAAAAACTTGCTGTGGAGCTGGAGAATATGCACAGGTGCCTCGATCACATCACGACGCATGTCAATGCAGTTTGCACAGATAATTTTCAGCAGATTG
CTCTTGTTCAAGGGCATGTAAAGGAAGCTCTTGAGGTGTTGAAGAGCCGAGCTGGATCTGGGGCTCAGAACAAGAAAGTGCCCGAAGAAGACCCAACTAT
CAAAGTTGAGGCACTATCTGATATCCGATGTGGAAATACACAACAAAATCCAGGAGCGAAGCGACTGGAAGAAAATGTATCGCGCGTCAGTGAGCAGGTA
AACAATAATTCTTGATTCTATCGTGACTTACTTATTGACTGGAGTTTGTTTTTTTAGATTCGACAGCTAGTGGACATCACTGAGCAATTGTGCGAAATCG
CAGTTGGGCAAATGGAAACTGACCTTAAAAGTGTCATTATCAACAAATTGACACAAACGTTCACTCAGTGTTTCTCCGAGAAACTTCACACAGTTTGCTC
TAAAGCCGACGAAGCCGTGAGTCTCTTGGATGCTCATGGGCCGACATCAGAGAGTGGACTCGCAGCTGTCCGACCTATCAACTAACATTGTAACAGCAAA
GCAGTTAGTTATGATCTTACTTATTAAACGGACTTTAGTAAATATGATTTACTACCTTTTCGATATCGCTGTCTCAAGCATTATTGTCGTTTTTGCTTCA
AAGTCTTCACTGTCAACTTTTTTTATAGAAGTATCGCAGCCAACAATCGATCCAGCGTCGTCCTCTTTGTGAGAAAAAAGCTGCTCGACCAAATACCTGT
TTGAGTGACACTTGTCTACAAGTACCTGCAATAACATCTTTGACTGCACAATTTTAGCCGCTGCGCCTGCCATCTCGTTGACCTCTTTATCCTGAATCAC
AATTAAGCGTCTTACGATTCCCTTGATATGCTCAAGAATCTCTTCATGGGCTGAAAGCACGCTtcggcgctccagcgctgcAGATAATACCTCTCCactc
gtagctctttgccctGCAGGCGTTGGGCTTTTCATCGCAGTGTACTCCAACAACCCTACCAATAGGTCTGCCATATCCTTCCAAACAGAAGCAAACTTTG
CACAAGTCTGTAGCTTCGTAAACTCTTCACAGAAGACTAAAGAAAGCATTTGAGCAACAACCACATGTGGTCGAAGAGTCAATGGGTCTCTCACGGACGG
TCGGCGTCGACGGCCACTCACTCGTTTGGTGTCGCTATGAGCGTGCATCTGTTTTGAATATTTCTCGTCGTCTATTGAAGGCAATTGTCGTCTATAATAC
agaaaagaagaatttgTTTCTTCTTCGTTATCGCCAAATGGAATTTGTCCATCAGAATCCTCATATTTAGGTTCATAGAGTAGACCTAAACCAATGGGAT
TCAACCCGTACCGAAGAATGTCAAGCCAAGCCCCGGCCATGAACGATTGATCAGTTCCAGCGTGCGCACATAGCATGTGCTTAAATCCTTCAATTACCAG
AACCACAAGTTCGTTTGAGAGCTCTCCTTTCATTTGGTTTAACAAGAGCTGCCTCGACACGATAGCCATTCCGCCAAGAAAGCGCAAGCGTTCTTCTACA
TAGTTGGGTACATCTGTGCGGAGCGTATCAAACATAAAGAGAAGCAATTCAATGGGTCTTGAAGGTGCATATAAATCGTGCAGACCTCGGTATTTCATCG
CGAACATCATCATCTTTAGATAACAGTCACTGATCAAAATCTCATTTCCATCTCCATTCCATATTTTTTCTATTACAAGACGCTCCAGAAGTTGAAAGCC
GTGATTTGCTGCATACGAACGCTTGATTGACCAACTTATCAGGTTGCAGATTGTCAGCCAATTCACACGGGAATAGTGCAAATTTTTCGGGCGCATCACT
GCCACATAGCGATCCAGTCCGCACATGATGGGCGCCAGAAAGGGTCCAATTAGCTCGTCGTCGCCGCTCAACTCCATCAAAGAGCTCAAGAATGTCACAA
GCAGCAGTCCGTggacgtcacttcgtgtatGTGTTACCCAAGCAAACAAACCGTTCATCGCCTTGTACAACAGAAAACACGCATTTTCGTACGACAAATT
GCTTGGGCATTGATTAGTGAGTAGTACTGGTCGTAAATGCTCGAGTAATTGGGTGTAATGTGCCTCCAACACAGCAGATATGCCATCTTCTTCACCAGCA
AACAGCGATCCGCTAAGTGAAATACATTGGCTCAGTAGGTGCTCAAAGAATACACAACCACCTTGGCTAAGTACCAATTTGGTATCTTTCGAGGGCTCAT
GTTCATCAGAACCTCGCAGTACCGACATGATTTCCTCATGCAGCGCTTTGATAACTTCAACCAGGGCGCGAGATGGCAAGCTTGCTACATCTTGCAATAT
AAACTCTACACGGCAAGGTTGTAACGTATGTCGAATCCACTGGTCTGTACCAATTTTGATGTCATCACCAGATGGCACCGTTGTTGGCGCTTCTCCCTCA
ATGATAAGATCTTCAGCGAGCAAAGCGAGCTCAGTGGGGCTACGCTGATAGTGCTCAAATtccgtcagtgacgaataTCGAGTAGTTGTCATAGATTCAG
GGGTCGAACGGCCAAGATTCGAGTCAAGCGCCGTTAGTAGCCACGCTACACCGCGAAAAAAGCTACCAGTATTGTTCTCATTCATATCTTGTTCATAAGC
GCGAAGTTCAATCTTTCGTTCCAATTCTGCTTTGTTTTTGTAAACCATGTTAATAAAGTCCAAACGCTCGTCATTATTTAAAAGCTCCAGATTCATGTCT
TTGCTAGAATACAAAATTTGAGACGGTAAAGCGCGAAGTtctcgcaatccgcttacgaggtgaaaaaaatatttccagGAATGGCTCAGAAGCGTCAAGC
TGTACGAGCTTACGAGCTTTAATACCCCTGCAGTTGCTAATGAAGCACTTTCATTATCACAATACACTGATATTCCATTTTTGCGGCCATTGTAGCCGAC
AGGATAAACATCTGACGATAAGAGAGCCGAGTACTTGCAAAGGCGAATAAATATTGTGTTGCAGTGCTCAACCAATGACAAATGAGATGCTACTGCTGCG
CAGATAACGAAACCGTTGCAAGCGAGCTGTAGTGCCGTTTTCTGTGGCAAATAGCGCACCTCATAACTACTTCCCACGCCGAGATCGTCACCACGAGAAG
CATCCTTTGCTTGAGAGTCTAAAACAAACTGATGAAAAACACTACTAAAGGCTAGTACGAGGCTTGATTGGATAAGCTCCAAGATATGACGATCGTATTG
ATTACCTGAGCTAGCATTGAGTGGTATCGGTCCATCAAAATCATCTTGTTGTATCCACTTACTGCTTCTACGTAAAAAAGGGGCTCCAGAAGTGGGGCAA
GGGGCGCACTTGGTAGATTCCTTGTATGATTCCACGGCATTCGAGGATTGTGTTTCGCAGTCACAAGTTATGCTTGATGAGCGGAGATGCAACGATAGGT
GATGCACAATTAGACGAGAGTTGCGTGGGTCACTTTCGGCTTGGTTAAGTAGATCCTTCCAGCGATCGCTTGTAACTCCACCGTGTTTCCCACAATCTTC
AACAGTTTTTATTTCATCCTTTAGTATTGCGTTATATAGCTCCGTCAAAAAGTCTTCCGGCAAATCACGACCTTTGGAAACCTCCGGGCCGTAATTTTTA
TTATTCTTGATAAACTCCGTCAATTTCATCTTCTTATCTGCTCGGATATTTATATTGTGCAGATCCGTGTTGAGCATAATCAAACTGAATGATAACAAAT
AGGCAACATCTGCGGATGCCATGAGGAATCGCTCGCGACACTGCTCATACACTTGGATTGAAAACGTGTTCAAGATTCGGTCGATTTGTTGAGCTTCTCC
TGGAAGACGAAAACTTGCAAGGAACATGCGCAATGCTGTGACAATACTTTCGCCTTCAAAGTTGAAAGATCGAACAAAGTTTGTCAGGACATCACGATGA
AAGTCCATTGTATCAGCCTCATGGATGTCCGTCTTCTCGAAGCCTTTGACTTCCTTGCCCATTGCACCCAAGTAATTACCAACTGCATTCTTGTTCAAGC
CTTGGGGAAGAGATCGCAAAAACGTCGCTAGTGATACACTGTCAAGTGGAGTTGGCAGGAACGTATTTTGCTGCAAATACTTGACTCCAGCTAATGGCTT
GCGATTGAATTCCTGAATGCCATGCTGAAAAAACTTTTTGCGCTGTCGATTCCTAAACAACTCTTCAGCAAGAGCAAATTCATCAGCGTCGGTATGTAGT
ACATGGTCGTCTTGATCCACCAGTAAGGAATCCTCTCTCATTCGATTATCACTGTGGTCTAGACAGCTATTTCTACTCCCGGAAGACAATTTCGGCTGCG
TACGTAGATGCACGATATACAATGCGTTGAACATTCCGCGAAGTGTTGTTTCTCCAATTGCTTGCGCCCACAAGAAATGATCTTCATCATGTGACTCAAA
GCAAGCGATATGAGACTGCTGCACAGCTTGTGATAACAGCTCAAATAACGTCTGTGTTAAGTCACAGCGATTGCCATCGCAGTCATAATTCACGTATAAG
TCAGGTAGCAATGTTGCTTCAGCAAGCAAATCGTTCAAACAGTCGAGAATTTCAAACGAAATGCTATATAGCTGCTGTTTGGAAAGCATCATGCCTGAAA
ATTCTTCGTGCGCAGCATCAACCATGGTAACAGATTTGTCGTCAATGTGGTCGAGGGTGTCTGGTGCAAGTCGACTGGTGTCGTCTCCAAGCGGAAAATC
TGGATGAGATACATCCATATTGGCCACACACCAGTGCAGCGTGTGAAAGAAGACGCCATTAATCAGAGTTTCTACTTGCATCTTGAGCTCCGATCGAAAT
TTGGACCACAAGAGTCGAATTAATCCAAGACACGCAACTGTAATTTTGGGTTCTGCACATGCACTGCATCAAGGACGGAACCATAAGTCTTAGCTACTCA
ACTTACAAAGAATGCAAATAAAGCACACAGAGCAGCACACACCCGAGTCGACAGTAACGCAAAATAGCGCAACACAGATCATCTTTGATAAACAATAACA
ACGATGGTTTCTGTTTGAGGAGTTCTGCGTCACATGCGATTAGCGCACGTTGTAGCAGTGTGAGCGACAATAAAACTTTGCGCTGATTTGTAGCCGTTTT
ATTTGACGTAGTAGATATCTCCGAAGTTGCTGAAGCGGCAAAGTTCCTCTGATGCAGCTTTTGACATAAAAAACCCGCGACTTTCACCGCACAAGGCAAA
CCAAAGCCCTGCCTTACATGTGACTCAGTTGCAGCAGAAATCGTATCGGAATAGATGGCGGGATTTGAGAAGATAAAGGTCATAGTGTCATGCAGAAACG
TCGTGGCAGTCGAACGCAACAGTACCGTAACATGTGCCTATACAGCAACTCAGATAAAATCTGGTGAGTTTATCATGAAGAGTGATTGAATACGTACATC
GTGCCGATCGCTGCAACTGAGAGCATAGAGCGACTCTACAAGCTGCCACATTGAATGGTCTGATAGTCTCACACCGCACGGTGAGAGCATTACTCCATGT
AAAACGAGCACAATCAAGACAAGCACATTTTGATCGCTTTGAATACCCGTTTCTTGAAAACGACAGTGACTAACAGCATCCACAATGTCCGAAACCGCGT
CCACAGTCGCATTCTGGTCCTTCACGTCACCCCAAGGCCACATGTTCAAGATATTTAGCACTGCTTGTAAAGCTACACCTGTTACGCTACTACCAGCGTC
TTCGTGGCGAATGACGGCCAAAAAAGGCCTAATAACATCGACAGGTGATAATTCCGCCATGACTACATTATATTCGTAAATTATAAGAAAATGCTTCAGC
ACGCGTTGACTTTTACTTACTATCGCATCGAAGAAGACGTCCACGTAGTGACGAAAAACTTTGAAAGACCGCATGCGGGCTCTCCTGAAGTCATACGAAA
GAGTGAAGGTCATGTTTCAGTTAAATTTGCGACAAGATGGCGTGGCCAAAAGTACGTATACACACCTGATTCACTCGCTGAGTAGTAGTTGAAGTCAGTA
AGTAGCCATGACGCTGTCTTGCGAGACTCAGTACGCACTGAATATCGCTCAGCAGCACGGAGCGGACAGCTGCCATGGTCTCAAATAATGTGACCGATTC
TTAACATCCTCTTATTCATGTCCACCACATGACTATTGTGTTTTCAACATCGACTTGGATTATAATCCGCAATACGACCAACGTGTTCCGAGCTGACAAC
AATGAAGgtggtggctctcgtgagcgGCGGAAAAGACAGTTGCTACGCCATGATGGAGTGTGTGCGTTTTGGCCACGAAATTGTGTGCCTAGCGCATCTG
CATCCATCGTCGCAACTGTCAGCAGATGACGCTGAGATCGATTCTTTCATGTTTCAAAGTGTCGGCCATCAGAGTGTTGAGCTCATCGCCAAGAGTATGG
AGCTACCATTGATCTCAGAGACTATTTTGGGTACTGCAGTGACAACAGACATTAATTATCACGAATCAGCAGTAGGTGATGAGGTTGAAGACCTATTTCG
ACTGCTACAAAAGGTCAAGGTGCAGTGTCCAAACGTTGAAGGTGTCTGCACAGGTGCCATCTTTTCTAGCTATCAACGCAATCGAGTCGAGAATGTGTGC
GTGGCAAAGTATTGTCACGCTTTTATGATGAATTGCTGATCATTTTTACTCTAGCTGTTCGAGAGTGGGACTCACATCGCTCAGCTACTTGTGGCGTCGC
GATCAGACCGAGTTGCTGCAAGAGATGATTGATTCGAAAATAGAAGCCATATTGATTAAGATTGCATCCATTGGATTACAACCACGAATGCACCTGGGAA
AGACAATAGCGGAGCTGCAGCCACAATTGATGACGTTGGTGAGTTTCAAAAGAGCAATTTATCAGCAAAGTGTACTGTATACTTATGTTATTTGGATAAT
TGTTTAGAAGGAAAAGTATCATCTTAATGTTTGCGGTGAAGGCGGCGAGTACGAAACTTTCACGCTCAATTGTCCATTGTTCAAAAAGCGCATTGTCATG
TACGTCTCTTTGTTCAGTGTGTCTTTAACATTTCTAACGTTGAGACTTGATTTAAGTGATGAGAGCCACGTCGTAATTCATTCGGATGACTATGTGGCAC
CTGTGGCGTTTTTGTCGATTGACAAATGCCATCTGGAGGACAAAACCCCCGCTAGTCCATCGCACCTGGCTTTGCGAATTCCTCGTATTTCGCCTCCTAA
TGTATCAAGGCCCACAAATCGTACGAGAAAAAAGCTAGCAACTATGCTCGCTCTTACGCCACAGGCAGCAAATGATCATGTGCCTACTTTTGGTCAATTT
CGCGACCAGTTGCACGTATCAGGCCTTATGAGTAGATATATTGGTGACGCATCAATTACTTTAGAGGAAGAAATCGCGGATATTTTTTCTCAGATAAAGG
CGATTCTTCAAAGCCATCGAATGGAATTAAACGACGTGTGCTACGTGCATTTATACGTCCAGGATATGTCCTCGTTCAGTCAGCTCAATGCCGAGTATAT
CCGGCACCTTGGTCAACACTTGCCCCCATCGCGTTCGTGTGTCGAAATTAATGCATTGGCCAATGTTCCAGCCCGTGTGCTTATAGACTGTTTTGCGTTG
CGTGGTAGTGGAGTTCAGAAGTTACAAGCTCTACGGGTGCGCCGTGACGTCTTACATGTCAAGAGTACGTCAAgttgggcaccaagctgtaTCGGTCCTT
ACAGCCAAGCAAATGTACTGCACCGTGCGCTTATATTGCTGGCTGGACAAATCGCTTTTTATCCTCAAACGATGGAACTGGTTCCAGGCGACCGTGCAAC
TCAAACAACTCAGTGCTTTTACAATGTCTGTCGTGTCTTGGAAGCGCTTGATTCAAATCTTCGTCATGTGTGCTCTAGTGTCATTTACACCACTGGAGAC
cctgaagactgcgggggtCGGGAGCGCCTGCTAGCTGACTGTCGTCGCCATCTACTAGCCAACGCTGAGCTGGTCGATGTATTCGAAGACGTTGTAGACA
GTGACGAGAGTGACGGTGAAGTTGACAAGAAGGAAGCGCGCTTGGCGTTTGTGAAAGAAGCTCCGCTGCTGATTGTTCAGCTGTCTCAATTACCACGTAA
CGCACTTGTAGAGGTGGAGTCTCAGGCGCTCACGCACATTGCGTTTAAATATCTTAGACCACAAAGTTTCACGCGCACGAATCGTCTCGGCAATCTTCGT
TTTGACTGGCAAACAGGAATGGTGCCACGAGCAATGTGCCAAATTGTGTGTACAGCATCAGCAGAAAGTAGTGAAGACTACTTAGATACAAGACTGTTGG
CCAAAGCTGTCGCAGAGGGAATGTGGACATGCATACTTGACAGCCTCGTCCAAGCTTTAATGCCCTGGGATCGTGTGGTACATGCTCGGACATTTTATGT
GGCATCAGCTTTCTCTAGTGAGATTGAGCTAGCTAAAATGTATCACAATACCGTCACGGCACGAGGAAAGGTACAAAGCATGCCCGGTATGACGTTTGTA
CCTGTGGACGCCATCCAAAGCAATGCGCTTGTTGCACTTCAGGTGACAGCGCAGGATTTGGACAAACTCGAGACAGAGCTATGGCTGCACAAGCAGATAT
AGCCACTTAGACGAAAGTGAGCTTGTAACAATCAATCAGTCGGATCTTAACTGCCGTAAAAAATAAAGCAATGAATGTATAAGAGTCCACACCTTTGTCG
CTATTCGTCGATAAAATGCACTTCCTTTACCTTGTCTAATGCCGACGTTTATGCCGCTGATCACTAGTTCGGCTACTGCTGGATCGATCATCGCGATTTC
TACGCTTCCGAGAATCGCGGTCTCGGGATCGTGCACTTCGCTCTGATCGGTTACGCCCACTTCGCTCCCTTTCCTGCTCAACTGTTCCACGGCCTTCACG
CTCTCGTGGACGGTCCCGGTCTCGGTCGCGATCGCGTCCACGATCTTCTCGACCCTTTTCGCGATCTCGTTCTCTAccaccatctcgacctcgatCTCGA
TCTCGTTCACTTACTCGATCTCGATCCCGTTCACTTACTCGATCTCGATCCCGTTCACTTACTCGATTTCGATCCCGTTCACTTACTCGATCATGGTCAC
GTCGATCTTCTCGATCTCTATCACGATTTCGGTCCTGGTCACTTATCCCTTTACTACTGTCCTGTTCATCTCGGCGTCCACTACTTCGTGGATCATCACG
GCGAGGGCGATCGCGAGACTTTGATCGATCGCGACTTGCTTCCTGTGATCCACCTCCAGGTCTTTCACTCCAGTCATCCTTGCCACTACTTCCGCGATCA
TCTACAACGCCACTACGGCCTCTGTCTCCGCCGGGTCCACCCATCCAAGGAGGTCCCACTCCAGGCCCAGCGCCCCATGGCGCTCCTCCCATAGGTGGCC
CATTCCAAGGCTGCTGACCCATAAAGCCTGGAGGCGGGCCCATACCTGGATGCCAGCCTCTTGGAGGTGGGCCACTTAAAAATGCACCTCGCGGTGGTGC
ACCGCCCATTGGCGGCAAGCCATTTCCCCCAGCGCCCCATTCTCCGGTCTGCTCATCTACACCATCTCCTTTCATTGCTCCTGAGAATCCCCGTGGAGGC
AATCCTCCACCTCCTCGTATTTGTAGCTTTGCATCTCGATCTCGCATAGCTTGCTGATTAGCTGCATTAACCGCCTGTCTCGATGCTTGCTCTGTCGACT
TCTCGACAGCAAGCTCACGCCTCAATCTCAATTGTCGTGTAGCGTACTCCCTCCAACTGTGCTCATCAAACCCATAATTAAAATAGTCGGATATATCCAC
ACCAGGTTTCCGCCATGGTCTGTCTTCGAGCAGATCTATATCCACATCAAATGCGGTGCGCCGTCCTCCGAACATGGTCATGTCATCCAACCCATCGGCC
GTGGATCCACCTGAATCTCCAGGCTGAGAGCTTGTCATGGCTCCAGTACTCGAAACTCCTGAGCTAGCATGTTGTTGGCCTGCAAAACTGCCACGGACGT
ACCGATTACCGCCACCTGTGAAGCGCAATGTAGGTTTGGTGCTCGCATGGTCAGTGCTCAACACAATCGCCACGTCCTCGTCGTCCTCATCGTCATCCGA
GTCCACTACTGGCTCGTCTTTTACGTCACAAGTAGCTGTAGCAGCAATTTCAGTCCCTTTATCAACCTTTGCCTCAGATTGTGACGTGGCCGAAGCGTTG
AGCTTGATGGAAACACTTCCATAcagttcttcgtcttcgtcttcaGCCTCTTCTTTCTTTTCAATCTTTATGACCATCTCATTACTTGTTTCCCAGGTGG
ATCTAGATTCTTCTGTTTTAGCTTCCTCTTTGACACTGATTTCGTCCAAGCGCGTGGTTACGAGAACATCTTCACCAAACTCCTCGTCCTCCATGACCTA
CCTACTTGGATACAAACGACCTAGAGGGACGATGATGTGATTAAGTACGTCAAAACACAAATGTCAATCGAACTTAAATGAATACTTAAAGTAGTAGATT
TTAGACGGTGATTGGCTTATGAAAAAATTCATTTAAGATTTGTATACTGACGCCTCCACGGCCAATAGTTTCACCCGACACATCGCTCAATTGCGCAGTT
CTTCTTGTCTCGTTCGACTTTTGCAGGTAAGCATGGATTTAAGTTTACTTGCGTGATGAGGAGAGAGGCAAATTTATTGAAGAGCAGCAGGGAATGAGAT
GTCAATACGAGCAAAGTGATTGCAATTTCGAATGTAGGAATCGTCAGAATCGTTAGAATACAACGTTAAAGGTTGGAGCTAACAGCTACTCTTCAATTGG
GATACTGAGCTATGCAACATCTCCTTTCGTATCTACCGCTCTCTCCTTCGCCACATCTTTCCAAAGTGATATGACGACGAATTCTAGTGCAAATACTAAT
GGCTTTTGTCCTGTAGCAGCTTAGTCCAAGATGCCACACTCTTTCGGTTACCGTGCTCGCACGCGCGACATGTTCGCCCGTCCGTTCCGTCAGAGCGGTG
TTATTAAGATGTCGACCTATCTGCGAACATTCAAAGTGGGCGACTATGTGGACATTAAGGCCAATGGTGCCATCCATAAGGGCATGCCTCACAAGTTCTA
CCACGGTCGCACTGGCCGTGTGTACAACGTCACCAAGCGTGCCGTTGGTGTGCGTGTGAACAAGGTGGTGGGCAACCGTGTTATCCACAAGCACATTAAT
GTACGCATTGAACACGTCCACCAATCTAAGTGTCGACTGGGTTTCCTCACGCGTGTTAAGGAGAATGAGCTGAAGAAAAAAGAGGCTCGTGCTACTGGTG
TCCGTGCTCAGATTAAGCGTACCCCTGCGCTGCCCAAGGCCGCTTACACGCTCAAGACTAATGGCGTTAAGCCCATCACCATGGCTGCACAGCCATTCGT
GGACCTCATGTAAGTCGTTAGTAATGTATCTATTACTATTACTACGATTGCTTCAGTGGAGTGCACTCAATTTGTGACGGGCTAGCTCAAACTCTCGGGC
TTTTTTCTAATTTTAACGAGCTGAACATAATGAAAGAACGAGTCAAACTTTTCGACGTTCGTCGTTCTT