Description :
From Genome Similarity Track
Location :
Scaffold_3334:1391- 3443
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_3334-fgenesh-gene-0.0Glycosyltransferase
Pytar_ATCC12531maker-par_contig_3334-snap-gene-0.3SH3 domain-containing protein PJ696.02

Sequence
2052 bases(100 bases per row)
ACCAAGCTCGCCTCCGACGAGGCGCTTTTCCACTGCGTGCTGTTGGAGTTGATCGGTTCATCGTTGGCCTTCTTCTTCATCGACAAGTTGGACCACAAGT
CCGTGCTCTTTGGTACGCTCATCCCGGTGGCGCTTTGCGCCGGTGTCATTGGCTTTGACCAGAGCTCCAAGTTCCTCGCCAAGACGGGCAACGGCTCATT
GTACTTCAACATCATCTCGCTGCTGATGTACTTCTTCCTCGGATTGGGTACCAGTACCGCGCTCTGGACGGCTTGTATCGGTATGTTCACGACCAAGAAC
CGCGCCATGTCGACGACTTTCCTCTTCGGCATCTTCTTCGCACTGCCCGTCGGCCACGTGTTCATGGTCAGCCACAACTCGGATTCTTCCTCGGCTCTGT
CGGACAACGAGTACCTGTACTTGTACGGGCTTGCCGGTGTGTGTCTGATCACGATCGTGCTTCTCGTCATGGCCGGCACCAAGAGCAACGGTGTCATTTG
CACGCGCAGCGAGGCCGCGGCCGACAGCGAGCGTCGCCGCCGCAACCGCGCCGAAAGCCGCGCGTTGCGCACGCCGGGCAGTGCCCGCAACCGCAACATG
AGCCGCTCGCGCGCCAAGTCCAACGCCGGCGGCTACAACGCCTTCGAGTCCCCGGGCGGACGCCTCTCTCGTCGTCAGCCCAACGTGTAGGCGTCGTGAA
TGCCTCTCTCTCCCTCTGCTAGATGTCTCTTGTATTTTTTGCCTGCATCCTTTTTGACGCTTTTTAGCTTTGGGGTTTCCTTTCAATACACTTCCATTAA
CCCCACACGTCCATTGAGTCTGTCTCGACTAACTACTAGTAACCTAGTGCACATGCTTGCACGTCTTGCAGTTCTTGTTCCAGACTTGGCGAGTGTGCGA
GACAAACATGGGGCAATTGCAGAGCCGGCAGGGGCCCATGAGTGACGATCGGCGCTGGATCGACTCGCGGTGGATATCGGCGCCCTCNNNNNNNNNNCAT
GGCGTGCTGGATCGCTTCATAGAGCGGTCGCGCGGCATTGGGCGCCGCGACGTGGCCGCTCAGAATTTCGCTGGGCTGCAAGTCGCGACCGTAGAACTTG
CGGTTGAGATCACCGCGTGCGGCAATAATCTTGCCCTGGAGCGAAATACCGGCGAACAATCCCTTGCTGTGCGAGTAGCTGTAGTTGGCATTGAGGCCGC
TGGCGCTGACCGCGGCAGCCGCCTCGGCCGAGCNNNNNNNNNNNNNNATACGGTCCGACCGCGAGGTCCAGTCCCGCGCCAATGTTGGCCTGCGGCTTGT
GGAAAACCTTGACCGCTCCTTCCGAGCCCAATATCACCATGAGCTCAATGAGCTCGCCACCAATCTCAAAACCACCGCTGAGTCCAAAGAGTCCGATCGC
CGACGGCGCCGACCACGAGCCATCGGGTAGCTTGGCGACCACAAGCCCCGTGCCAATCTGACCTGTGACGAGAAAGCCCGCCTTGATGATTGAGAGAACC
GCGAGGCCATGGGCCTTTTGTAGAAACGCCACGGGGATGCTGCGGTCTGCGGCGGCGCCCCAGTCGTCCCGGAAAAAGTTGCCGATAATGTCGGCGGCGT
TTTGGCACTCTTTAAACAGCGAGTTGCTGAACGGCACGTGGATGAGCCGCCCCTGGGCCGTGTAGGCGTTGTCTTCATTCGCTTTGGCAAACTTCGCCAC
GAGTTCGTCTTGGTACTGGTGGAGCTGCGGTGCGCACTGGATGCAGACGCGCTGCGGCAACGACGGGTCGTACCCTTTGGCGCCTTCGACCTGCATGCCC
TGGGGAATGAGCAATCGCAAGGGCGAGCACGAGCTGCAGATGCTGAGATTGCAGCGACGACTATCATATCCCAAGAGACCAAATCAGAACTGAGATAAAA
CGACGAGATCCAAATGAGACCAAACAGTAAGAAAACGCACCAGTGGTGTCGCCGCTTGGTCACGTCAAACGCAACGTTGCAAATATCACAGTTCGGATGG
TCAGCATATCTTCCCTTGAGCAGCCCCTTAGATGCGGGTGCCGGTGCCCCCG