Description :
From Genome Similarity Track
Location :
scaffold_11:1390295- 1393907
Sequence
3612 bases(100 bases per row)
gtcggcgggcaacacgggtgtcgtggtattcgtcaaccagttgagcaagatggtccatttggcggcggtgccagacaccatcgacggagtcggtacagca
acgctgttcgtggatcgtgtttttcgtcaacacggactcccagagtcgattgtctctgatagagaccccgtttcacgggaaaattttggttgactatttt
caaggtgctaggcaccaagttggatatgtcgacagcggatcatccgcagaccgatggtcgtaccgaaagggtgaatcgcgtcatcgaagacgttcttcgc
aacatctgcgctgagatgccgaggcgctggagcgccatgttgaaAATCGTAGAGTTCGCACTTAACAATGAAGTGCATTCGtcaaccggctacacgccgt
tatacgtgaacgggctgattcaccctcgcgttccgctgacgcTACTATCCcacggctcagggcttggtgggaaagattagccgaacggctagctgatgcc
agcccccttaccatccgtaaagaagtcaatgacttcgTGGCTACCAGACTGCGTGTCCTACGctcgttcgcgatgcgatggctgaaagccaatccCTGCA
AAACGAATATGCTGATGAAAAATgaaggcaaagtggaaagctttaaggtcggggatctagttttgttaaattctaagaacctgcctacacatgcagcatc
tgctatctttcggacgaagcttcgtccacagtttattggaccgtttaaggttgtggccaagcgggtcctagcgtatacgctaaaccttccgaaacggatg
cgcacccacccggtcttttacgtgggcttgctcaggCTGTACcaagatccggcgcaagcaAACACGGAAGCAATGGCGCCGGAACGGATCACACGGGTct
tcggccacccagaagttggccaacaactggttctgagcacggagtgcaacaacctccatttccaatgaagccgagcgctccaccgttgcttgcagcgatg
catttgcctgctccacggctaagGGTCGCCCTGGCAGatcgcggtagtcctcaaggcgagacagccggcgcacgacgtgctttcaatcatcaagagcgtc
cacacagcgatatgctacttcagcatgacgctcagcggagctccggtCGCGGaggcctcgtcctcaagggctcaaagagcatcacaagtcaccggacggc
ggtcggcccggtcgtcaccgcccgccatcGACTTTTCTCGATATgaatggtgacgtccacgatcacgtggaacgtcttgctGGACAACGTCGTTACCGgg
gtcaaacccaacatATGGTGAAGTgtcggggatatcccgaccccgaaaactcgtgggagtttgaggcgccacttcggcaagatcgcccattcgccgtgga
cgcttttgatcggaaagatcaggacgtcccgcttcatcagacgcctcgcgcttcccggcaatagccagtgaagtagaagggtcatATGCTGagttcaagc
agtggccctgagctcttgtgtTCGaaaacacagagctcgcgggagcgttaaggGTTGGGTCCATACGACGAGAGGCgacaattcgaaggaagtcgacggc
gtgccttgaatttggcaaactcaaatcggaggtgtcgctccacatgcacgtccacttccttgtggctcgactGTAGGTCATACAGtttggaaagttttcg
gtgccattACACCCATcgttcaaagagcgcttcgtcatctgtagcgctttcgtcaGGGTgaacaggtattgtccgcattgcgggtacacgagagccactc
gttgagcactcggACGAGTGcgaacggaaattcttgtggaaccaagaatcgagctcgaagagccttccgTTTGTCAAGCTCATCCTCCGCTCtgaccggg
ggcccgatgatgcggacgcgtaacgatcgagctaCAGCGTCTTTCTCTTCCACAgagggatccgcagggcggaagccatattccacacgagggtcaatga
ccggccgtggatggNNNNNNNNNNAGCTAAACCGGCAAAAAAAACTATACAGTACAGTGGTACAGACTATTTAGCCAAGCAAATTGATAACTCTCCTGTC
TATAATGACAAATATAGACGTCCTTtaactgagcactgctcatatttcgaaacagttgctgcatgccagaatagcatggtcggacgaggtccgatgCAAC
CTGGGCAAGGCTTTTTTATGCGAGTGGTGTGGCACGTTAatcactggacaaagactgtgaAAAGAGCAGcgcttcgtcggatgttgttaataacatcatg
gctccgatggagcagaaagtggagacattggacgacgctgagtgcgtaaaTTTTTTATAGAGAGGCGACCGCGATACcatatgttatctgcaagacgcgg
agcgtcgaccctgacccagtgTGTCTctgccgtagacgatagcgcgcaTCTATATACTTGTCAATGGTATAACAGgagagaagacggcgacgtcaccctc
gaggctattcccgcggtgagATTTTTTCTGGAGATGGGCGAGGTGTCCTACGAAGGGTTCGGTGGTATCTTGAAGACAGgaaatttagccgaggtggtca
ttataccaactcgtcgtcgcttttggAAGATgctgtcctggagaacactaagagggtgctaaaCGCACGAAATGGATCATCGATCCTAAAGGATTCCTCA
GATCCGTTCTATTCTTTGGTCAAGGATTTTCAAGACTTCGTTTTCGAAGACCCGacttcagtcctacctccggaccgaggtgtgcgtcatgagattgacc
tggttccgggagccaaatactgcgtaacacgccaatgccctgcccaaagagcagtgtgacgtcattgacgcctttttcgtgtgaagcacgaggcagggat
agtgcgtgagagcaagtcttcccacgttttgtgtcctgAAGCTGAactgcaagtggcgtatcgtttacgCTAACATTTAGCTAAATgctaccaccattcc
agcacagacgccgaatccTAGGGAGGGTGttatccagaacaatatggttggctgtacaatgtacagcgcactcgacttggtcgatgaataCTTCAATTGC
TCAAGAAAGCGATAATTATTCCGGTTTACAGCGGGGATTATTCTAAGCAggatgctctggaagtggctggtgatgtaccaagggctgtcaaatgcaccag
caacattaaatcgtcttgtTACGCAACTGTAAGGCTCCATCGAGCGtctgcacagacatacttcaacGAAATCTTCGTCCGAGGTCGTGCGGGACAcagg
aggacagatgtgaaAGACCAtctcgttcatttgagagcggtgctcgactgcatgcgcacgaataagcttaTGCTCATGCTGATTTGTGATTTTTTGGagc
ggaagaaattccctttttaatGTGCTATATTGGGAATCGTGGCTTTTAAGCGGATTACCGCCAaggtcaaagccattgtGAGCTGGTCGGTTTTAGAGAG
CCAAAAaggcttgcgcaagtggcggggcctcgccaactacttgcacaagtatagcgcaaattatgcggaaatagcacggccattgtcgaatctccttttC
AAGGACataaaa