Description :
From Genome Similarity Track
Location :
Scaffold_819:1390- 3780
Transcript NameFunction/comments
Phyke_g11105conserved hypothetical protein

Sequence
2390 bases(100 bases per row)
TTTGTATGTTGTCTCAATTCAATCTTCACTCCGCCAATCAAATAGCGGAGACTTTCGTCTACTTCAAAGAGAGGTGTCACATGTCGCCGAACGAGGGCGA
CTATCAATGAAAACATGCCAAAAGTTACAAAAGAGTACACACTTTGCTCTCTGCAGACCTTATTTCCTGCACTATCCGGTTCACGGCCTGCCCATGCGCA
TCTGACGCTGATGCGATGACCTCTTCACGTCGTCAAGCAAGCAAGCACCGACCAACAGCCCCAGATTGccatcagcaccacgttTTGTGCTTCCAGAGAC
CTTTTCTGCATTGTTAGATCACTCGGGGAGGCAAAAGAACTCGCCCTGTTTGAAACATGAGCAACGATCACTTGTCGTCGCGGCGCTCCAACAGCTCAGA
TAGTGCGTCCACCGTTGCGGGGCCTGTGAGCGTGGCCGGCACCACCAATGGCTACGGTTTCCGAAGCGCTGGCGGAGATGCTCTGTCCATCGAGATGCAA
TTCCTGAATCCGCGGAGACGCTTCCCGCTTGCAGACGAGTACTTGCCTCTTGTGTACGTCACACACGAACAAGTGGAAGATTTGCGGGAGACGTGTGAAC
AGCTCATGGCTGATGCACTTGAGCTCGCCGGAATGTTTGCGTGGGAGGACAGCAATAATAACGAACTTGTGGGGGAACACCGCGATCAATGGAAGGTGCA
CTACCAACGCCCGCATGTCACGCTGTACCGCAAGAAACGGGGGAAGGATGCGATCGCTGATGAGCTCGAGGATGCCACGGATGATAGCAACGGCGGCCTG
AGGCACTTCGTAGTAAGTGGGCAAATTCACGACATGTCGCTTGAGGACGTTGAGTATGGACTCTATTGTGATGCCACGCTGGACGAGCGCGCCGTTATGA
CAGACTTGTACCGCGAACTCTTCCTGGATGCTGCCGTGTTGCGCAGCTTCGAGACGCAGACGCCGGAGGACCCGTTTCACTTCTTCGGTATCAAATGGCT
CGCTCACCTCAGCCCGGCGGACAAGTTTATCTCCCCGCGCGATTTCGCTTTCGTTGAGTATTCCCAGCGTGCAGTGGGTCCTAAAGGAGAGCCGCTACTC
GTCAAGGTGCAGCACTCGCTGAGTTCAAAGCATGTGGACGCCATGAATCGCCGCGAGTTTGATCTTGTACGAGCACAAATGAGCTGCACCACAGTATACC
GCCACGACAAGCGTGCCAACAACGTACAGGTCATCGCCCGTGGTCACTTGGATCCATGTGGTAATGCGCCGACAATCATGACGCGTGCATTTTTGACACG
TTTGGCGCCTACCCTCGTGGAAGTCGCGCACAGCGCTGACGTCAAATACATTATGCGCCACGGACTTGTGCTTCCCAAAGAAGCGTTCTTTGCGCGACGT
AATGCGCTCAAGGCTCACGGTCGCCACCGTCTGCAGTGTACGGCATGCGGTAAACGTTTCGGGCGACTCAAGCGTCACTTGACACAGTGTCGCTCCTgcg
gagaagcagcttgCGGCCATTGCCTCATGACGTACACGCTGTGCCTTCCGAACCACGAACGCCGCGACGCCGAACACCCGAGTGCAGTTATTCCGGAGCG
TTTTTGCCTTCGCTGTCTATATTCTGGTCGGGTTGATAGAAAAGGCCAACGCATGGATGGCTTCCTTATCGGCGGACAGGACGCCCCATCCACAGCAGGT
CCGACAGTCGAtgatgaagtcgatgaagatgatgatgatgatgtgtCCGTCGTGGAGTTTGCAATGCTGGGTGAGGGTCCTGGCCATACGATGCACGCTG
CCATCACAGAAGCACAGCGTTTGCAGCGCCTGAAGCAGCGTTATCTGGAGAATGAAAAACGCAAATACCTTTCGGGTAATCATCAAAATCCTGTAGAGCG
CTTCGTCatggatcagcagcaaatacacCGCAACGATCCGCAGTTACTTGGTGCAGGTCGTCCCCGTATTGGTCGGAGAAGTAGCCAACCGACGATGACC
AACTCTATTAGTTCGTCTTCGAATTCGTCGGCACCATACTCGTCATCCACCTCTAGTCTCTACTCGTcgccagaagctgctgcagcagctacggCCGCAT
TGCAAGCCACCACTGGCTTCCACGAGATGAACCATTCAATTGGGGAACAGAATGCGTTGATGCGCTCACTGCAAAGCGAGTACGCCAAAATGAGGGTGGG
TGTCCAGCGTTCACACTCGAACCCACAGGAGATGCGCCAAAATCGCTTGGCAGAATGGCAAGCCACTGAACACCAGCACACCATGGCATTGTCATCGCCG
AACCTGAATGATATCGACAGTGATTAAGACAGTCGAAAAGTGAGTGAATGAGTGAGTGAAAGTAGTTTTATAGTAGTTAGCAAGCCCAAG