Description :
From Genome Similarity Track
Location :
Scaffold_3838:139- 1969
Sequence
1830 bases(100 bases per row)
GTTGTCTCCCTCCACGGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCGCTTGTGGCACGGGCGTTCTCATACCCTGTTCGGCCAGG
AAACGACTCATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGCGAGACCGGATCCGTGA
GGCGATTACCTTGAGCTCGATCTGACGATAATCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTGTCAGATTACGGGTAGGGCGTAC
TGGATCCCGAGCCTTCACGCTCACAGGGACTTCCTGTCCTCGGATCCTCGCCCGTGCTTCCAGCATGGATGCCCTGGAGGGTCCTAAAGTCATGCGTCGT
GGCTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGATCCTCGGCGACGACACTGGATCCATAGTGCGCG
ACCTTTCTCCGGTGATGGACTTAACTTTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAAGTCTAGCTCGAAGATGTCCTCTGCGTCGAGCAC
ACCAGCTACGATGCCTGACTCCGTAAGCAAACGTTATAGATCTTTGACTGCCACCAACTTGCTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGA
TCTTCGATCTGTCGTGGATTCAGGATCCGCATGACAGGATCTTGATGCAGGAAGTCACGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGG
ACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTTGTCTTACTCGTTTTCGTCTTCTTTCTCGTTTCTTC
GACTAGCGGGCTTGGGTTTAGGTACGATGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCT
TGACTTACGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGCTTTTTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGA
CAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACTTCCGACGACGCCTCTTCCCCTGGCTCAAT
CTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAAAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAAT
CTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTG
TGTACCCGTCGGTAGGGCGGAATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGCCGAGACGTGGGGATGGGGTGGAG
CAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTAGCCGT
AGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTGTTGTCCTTTAAGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTGAGAGCCCCTAGGG
TGTAACCGACCAAGTAGTAAATTCGGTTAACCTGTCGGATCTGCACAAGTAAAGGAAAAGCTCAATAGGTTGTAGGATCTGGCCAATGTATTATCCAGTT
ATCACTACCAACACTAGATTCGCAATTCCC