Description :
From Genome Similarity Track
Location :
Scaffold_423:13897- 16639
Transcript NameFunction/comments
Phyag_g5590hypothetical protein PHYSODRAFT_263945
Phyag_g5591hypothetical protein PHYSODRAFT_284636

Sequence
2742 bases(100 bases per row)
CAGCTGCGTCTGGGAGCGGGAGGCGCCTTGGGGCTTTCGACGCGGCTCTGGAGCGTTGGGGCGTTTCTTGAAGGCGCCTGCGCGGTGGTTCGGCATGCAC
AGGTAGAATGGACAGTCTGGATAATAGTCTGGATAATAATACACACGTCAGTAACTTAGTGTTGAGGTGGGATCAATTCCGTACCGAGTGGTGTTTGTTT
GCTCGACTAATTTCTGGGAGTGGGCAAGGAGAGCGActtcgcggcggcggcgtggcgTTGTTTAGCCTGACTGCGCCACGGGATATTCGGGATTACGCTC
GTCCTCTGTGCTGGAATTGAGGGCGAATTAGCCGGAGTTTGTGGTAAAACGGTGGCGGGCAGTGGAAGAGATACGGAGCTTGTCACAAGGTGAGCTCAAG
TCGAGCAAGTGAAGTActgtacaagaagtacatgcACATGTAGGTGCTGCTCCGAGCAGTGCTCGTTCacggcggaggtggagctgaCATTGTCTTGTCC
AGCGTAGAGGAGGACCCAATGGACGTGCGAGCTCCTGGATATTTTGACGGATGATGGCGGGCCGAATTTGGTATCGTAAACGACGTCAAGGCGTCTGAAT
GGCCTTCGTCCGCAATGATTACACGGATAATCTGGCCAAGGCGACAATTCTTCTTGCATAGCTGTGAATCACAGCCTGTGATGAAGATGTATTCATACAC
TGTAAAACGAAGCTGAACTGACGATACCCTACGATCGCTTCAACCATTCCGTCCTACATTGACGACACGCAAGCCGCTAGCAGACAGTTGCAATCTCGTC
ATCTACATCTACAGCAAGAGCCCAGCGACCACCGGAACGATCCAAGACCATTTGAGGCAGCAAAACGCAAGTCACCTAAAGATTCTTGCAATGGCAGGCA
AATAAATTAGCAACTGATTATTTCACAGCTTTTTCCTCGTCTCTCTCCTTCCATACTGTATGCTTTTCTTTGACCTGTCTTCCCAAGCTGGGGCCAAGCT
GCGCCCCAGCCGAGCACCATCAGTTtatctccttcttcttctccaaccaGTTCTTCTGCCTTCACGAAGACTTTTCCCCATTAACGAACTGCGGGCGGCG
ACAAGACTGTTGCTATGCTGTGCCCTCTTAGCCCGACGcggcctgcttcttcttgtagtcCGAGATGGCGGCCTTGATGGCGTCCTCCGCCAGCATGCTG
CAGTGAAGCTTGACgggcggcagcttcaggtgTGACGCGATGTCCgtgttcttgatcttgaggCAGTCCTCCACGCTCTTCCCCTTGAGCCACTCGGTGG
CtaccgacgacgacgcgatGGCCGAGCCGCAGCCGAACGTCTTGAACTTCGAGTCCACGATGGTGCcgttctcgtccacctggatctgcagcttcatcac
gTCTCCGCAGGCGGGGGCGCCCACGAGGCCCGTGCCCACGTCCTTGGCGTTCTTGTCCATGGCGCCGACGTTGCGCGGGTTCTCGTAGTGGTCGATCACG
TTCTCGTGATACATGCGCGTCTGGCCGAAAGCCGACGACGCCTTGGAGGCGGAGCGGGCGGCCGCCAGAGAGCGCTTCATTACCGAGCGAGCGATCATAT
TCGTTAggatttcttcttgggaCTTCTTCCACCTACGGATTCCGTTGCGAAATGAGTGACCTTTTGATGGGAAGGGCTGAGCGGGCttgtgtgcgccaca
cagACGGTTTGAGGGGGTGGCACGTGCCTCGGACCAATGAAACCGCAGATACTGCGGCATCTAATCGTATGGATTATGGCAGGTGGGTGGATTTATGAGA
TGggattggttgaaaatgCGGTTTGGCCAATCAATGACGCCGACAGGTGACGCGCCGCTGGTTTAACAAACAGAGAATGAATGTTTTGGGGGAGTCAACA
CCACCAGAACAGCTCGTGGTTGTCGCCGCGGCTTCCTGCTATGctctgcagccactgcaacagTATCTGTATAGCTTCCGCGCGAggtgagctgctcgtg
atGTGCATTTATTGCAGATGATCTATCCAGGCGAGTCAGCATGCGAGGAGGTCATGTCAACGAGGCAGGAGCTGATACCTGGCCCCATGCCCGCTCGCCG
AGCTTAAACTATGGCACGCGAGCGGCATGGGTGTGGCCGACATCGGACGTGGCGAGAGTGTTGGTGTGCGTGGGAGTGATCAACgcgtcagcgtcagcat
cgACACGGGCTACCGCTTTCACGCTTGGCCTTGGCAGGACGGAGTTGAAGTCAAGGGAAGCCTTGCATACTACATTAGTCAGCTTCAAGGCTCAAGACGA
GGATTGAGACGAGTCTTTTTCACCAAGTGATCCCGTGCACGAGACTACTTGACATTTTGAGTTCAGCTCCAACTGTACAGCAGATACAGCCGCAAGTGAG
TGTGCTTAGCAGCTCCTGCGGCACATTCTCGTTGCTCTTCCAGTAAACAGTCGCTAAAGGGAACACGATCGAGCATGGTTTGCGTTTCCTAGGAGTGGTG
ATCGACGCAAACACCTTGTGTTGCCGTAGTGGATGGCCACGCGCGCTCGCCATCTAATTAGCTGTGGGCACGCGCCGgcctggtgctgctcaactGGTCG
TCCGAGGCACGTGCCAGGGGGTTCTTCCGAGTAGGGAGCTTTCATCTTGCGACGCAAGACGCGCGCGATGTAATTGACTGGCGAGGCTGCCGTGCAAGCC
GAGGAAATGAGCCTGGTGTGAACGTACTGTTGTTGATCCTTT