Description :
From Genome Similarity Track
Location :
Scaffold_546:13897- 14910
Transcript NameFunction/comments
g8127.t1ETO84080.1 hypothetical protein F444_01991 [Phytophthora parasitica P1976

Sequence
1013 bases(100 bases per row)
ACGGGTTGACACTGAAGTCTGTGGACGTCGAGATCATCTCGAACGAGGAGTGCGACTGGTTGAATAATGCCACCGTGACGAGCGAGACTCAGCTGTGTGC
CGGTATTGGAGATGGCAAGGACTCGTGCCAAGGAGACTCTGGGGGCCCTCTCACTGCCAATGGTGTCGTTGTGGGAATCGTGAGTGGTGGGCCTCCTACG
GATTGTGGCGTTTTACCTGGATTTTACACTCGCGTTTCGAGCGTTTTGGACTACATCAAGGATATCCTGGGCGGTGGTTCCACTGGCAATGTCACGGAGT
TTTTGACAATGACTTACAATGACAGCGCAGGCGCTAGATCCATGCCGACTGACGAGCACTGATAGAAGGGCAACCGCAGGAGGAGGGCAGAGAGGGTGCG
AGATTGGCGAGACGTCCGTGTATATAGTTAATATATACAAAGAGTTTTACACGGTGTGAAACCAGGGCTTCGCATCAACCAGTGATACTGAGTACAGTAT
CTGCTACTCAATGCTATTTACTGTATTAGTATAATAGTAATTCTCTTACTAGTGCGATGTGGTACGTCCCTCAGTTCTAAGAAATATCCAGGACAATTAG
TAGCGCTTATCTTGGACACTATGGAGCTTCCAAGATAATCGCAGATGCAGCACTGCAGTTCATGTATGCTATTTAGCATTCCCAACCTAGAACAAATCTT
CTGGACCACAATATCTAGCGTTTTCAATTCTCTACTTGCATCGACCCAAGGTATCAAAGCCATTTTTTTTACATGGAGTCGATGCCCAGCTGGAGCTTCA
TAGTGGAGCGCCAAACGAGTACCAGCCGTATTTCTTCTGTAATACCGTCACATCTCGCTGCATGCACTGTACTTTGTCGGTCATTTTGCTTATTGTATTT
GACGTTGATTTTGGCCCGCTAGTGGTTGAGCAGCACAGTGTGCATCTACCGAATATGCTACAGATCTGTCTCGAGTGTTTTCACCAGTTTAGTCACAAAC
TCCTGCGTCTGCA