Description :
From Genome Similarity Track
Location :
contig_69:13895- 15088
Transcript NameFunction/comments
g11622.t1hypothetical protein

Sequence
1193 bases(100 bases per row)
ATAAATGGAACGGGTTTCCCGTTCTCAACCTCACAAGTACAACGCGCCAATTGGGGTACTGGGTCGGCACCACACCAGCAGTTACAGAAAACCGGGAGAT
TCGAAAAGAGAAAATTCAGCGCAGAATATGGATAGCAACCACGATCAGCATCACGGTGGTCCAGCGTGTGGAACTGTTCAATGCAGTGGCACTACCCGCT
ATTTTATATACAGGAAAACAGTTTGTACCGACGAAGCAGATACTTCGACGACTACAAAACCTTCAGCAGTTCATATGGAAAGGACAGACGAGCACTGCAG
CGATGAAGAATAAGTTTAAGTTTGCATGTATGTTTACCCCACGCCAACGAGGAGGACTTGAACTTCAAGACGTCAAATGGTAACCCGAAGCAACCTTGCG
GAGAGGTGGCTTCAAGAAGAACCCGACCTTTATTCGGTAGCACGGCACTCAACAGTACATCCATACGAATCTATGAGTTCAGGATACTGCTCGTTCCAGC
CAACTAGCCAAACAATGATTGAGTCAATTTTGCGAGAGAAGCGTGCGTGAAAGCTAACGACAAATGTCCAACAATCGGGCAAATGTGAACTGTGGTGGGC
ACAGTCGGAGCGATTACTACCCAGTGAAAAGCAGAAACAATTCTTTCAGCTAGAAGCTGAAAGCTCCCGGCCGTTTCTAAAGCACCGTACTTCAGCTTGT
AGACTTTCTGGGGTGTTTTAAAACCATTATTGCAAAAACCGGCGGTGACTACACGTGTTTTGTACGGATGTGTTCCAAATCGCTTCTTTCAATCACTTGG
ATTTTGTAAATAGCAAGCTCGTATGGGACGATCCCTCAAATGTGTGAATGTGGTCAAATCCCCCCCCCCTATCACTCGAAAAGTTATCCAATGGAAGCCA
ACCACTTGGGGTGGAACTTCACGGTAGTTTCCTGAGCAGAAGTAAGGGTGGTAAGGCGGCCTTCTATTTTGTAACCGGGTACACCGACGTGTACCCATGT
TACATAAAGAGTGACGGGATGTCTCTCTTGTGTGCCCATGGTACGTGGTACCGGTTGGCGGTGAGCCAACCATTGGGCACTTGTTTAGCTTTTACTATAG
TTGACTTAGAGTTTGTAAGGATCAAGCTTGACTCACCTATAATATATATTCAGTCTTTAAACCTACCGTCTAAGTCGTAGTCGGTTCCCTTAG