Description :
From Genome Similarity Track
Location :
Scaffold_11:13892- 15167
Sequence
1275 bases(100 bases per row)
TCGCATACGAGCACAATTAGCATCACTGAGTTTAGTTGTCTTCGGTTGCTATACCGATTGCCATCACCCTTCCATTCGCAATTTCTGGCGGGAACTAAGA
AATCCATACTTCCTTTCGAAAGGTATGAACATTGACAGTAGTATGTCCCTGGCAACCCCGCAAGAGTGCCTTTTCCGATGTTTATCTCTTGATCTCAAAT
TTCATTGCTAAATGCCCGCATATTTTGGCAGGGACGATAGCTCTCTCGACCTCCGCAGCAACGCTTTATTTCCTACTGATTTAGTTTTGCCTTTGGTCCC
TTCAATACACCTCGGCTAGGGATTATTTTTTGCAAACTGCCACGTCGCGTGATACGCGTTGGTCTGCACCTCCATCTTACATGAACATTGGCGGTAGCGT
GCTGTTGAAATCGAACAGATGGGCCGGCCAAACGGAAAACAAATGGCAACGTACTGAAAACTTGGGTATACGTTTGGACAGTGTAAGAATGGTAACAAGA
TCTGAATACTCCTGCAGCGGCTGTACGATCTCCGCTTTAATTATAGAATTGATTCAACACCGCAAATAAAAGATGTCGACGAGGCAGATGTAACTGCTAT
CGATTTGGGTAGCGTGTACAATCGTTATCAAGTTCCACGGTAAAGGTACGAATCTGGTTACTTTCTTTTTGTTATTTTGCACCTACGTTCGTACTTATTC
GGTCGTCGTCTGGCTCCTCCAAAGCTGATCAATAGGTCATTCACAAAGCAACTGTCTATGTACATCAGCAAACGATGTACACGTGGCAGCTCCCCAGACC
TGGTTATCAAGGATGGGGTTAGAGTGAGGTACACTATATGATCTGCAGTTACCTCTCTAACGTGATGGAGGTAATGTGCGACGTAGAGACCAGCGTCCTC
TGGTGCATGGACGTGGGTCTCATCGACAATCAGAAGTCGTCCCCAAACTGTGGAAGCCCCCATGAAGCCTTCCGCCTCGGAAGCGTTGACGGTGGTCGCG
CAGGGCGATGCATGACGATGGAAAGGAAGAATCCATTGGCATACTTACATGCTCTTTTTTTAACGAGGGCAATCTTAAGCTACATCGCGCGGTTCGTCTC
CTCGTGACGTGGTGCATGCGGCTCTCTCAAGTACAAGCGATGGGGATGGCCGAGGTGTGCGAAGATAAAATGTGCGACTAGTAAGCGTACTGCCGCTCGA
CGTGCCCCAAGGAACTCATCAAGGCCGAGGTTAACCCCTTGCTTCCCGCCCCATATTCTGTATTATACAGAATAC