Description :
From Genome Similarity Track
Location :
scaffold_555:13891- 15381
Transcript NameFunction/comments
g9197.t1hypothetical protein

Sequence
1490 bases(100 bases per row)
TACGCGATCGCGCTGTCCCCGGCCGCCGACAATGTTAACGAGCCAAGTATCGAAGGACGCGCCATTCAAGCGCGCTGGATTGTCTACACGTCTGCAGCCG
TTGCCATGCTGGAGGCCTTCCACTACGGTTGGTCCAGTCACCAGATCAATCTGCACAAGTTCAACAACACCGAGGACTGCGACGCCCGTCCGGTTGTCGA
GGGGACCTGTATCATGTTCCCCGGCCACACCAAGACGACGTGGACTTTGCTGTCTAACGCATGGATTGTCGGTGGAATGGTAGGGAGCTTTCTGTCCGGT
ATCCCGTCCAACAAGTATGGGCGTCGGATGACTCTGCGCCTCAACACTATCATCATGGTGGTGGCCTCGGTCGTCCAGGTCATCGCTCCCACTGCCTTTT
GGTTCGGTTTTGGCCGCTTCATCGCTGGAATCGCCAACGGAATCGCTATGGCCGTGGTGAACACGTTCCTGAGTGAGATCTCCACGCCGCACAACCGTCA
CGCTTTGGGCACCAACACGCACCTGGCTGCGACGCTCGGAATATTAGGTGTTGCTACTACTTTCTGGTACTGGAACACCACGTCTGGCTTCCGTTGGATC
GCTGCAATCCCCATCGTTCTTGCTGCTGGGTATCTCTTCTGCTCGTACTTTGTCATGGTCGAAAGTCCGGTATGGCTCGTTGCTAAGGGCCGAGAGCAGG
AAGCCGAACGAGAGATCGCTCGTCTGTACGGCAAAGAGCACGTTGAAGCGATGATGAGCTGGATTCAAGCTCGCGACCAGCGAAACAAACTGCCGTCGAC
TATCAGTGGCGAATCGGTTCAAGTGGAGGCGGAGAGTCCGTGGACGATTCTGGTGAACCCGAAATTCCGCAAGCAGTTGGTGGTGGCCTTGGGTCTCACG
TGCATCAATCAATTGGTGGGGATTAACGCCGTCTTCTGGTACTCGTCGTCCATTCTGACTGCTGCTGGCATCCCCGATGCTCGACTGGGTGTGGTGATTA
TCGACATTCTCAACGTTGTGCCCGTGCCGATCGCCGCTTACGCCACTCAGTTCATCCCAAAGCGTCCGATGCTTCTTTGGGGCATTGCTCTTATGGCCGT
ATGCTGCATCGGAATGACCTTCTCCATGGTCTACAGCGTGGGTTGGCTCTCCGTTACAATGCTCGGCATCTACGTGGTTGGCTACGACGTCAGCATCGGC
CCGTTGCTTTGGCCTATGATCGCCGAATTCTTCCCAGACTCGGCGCGTGGCGGTGCTGTCGGTATCTGCGTCTTCCTGAAGTGGACGTGTGCGCTCATTA
TTGGCATCGCGTTCCCGTACGTCCAGGACGCCATCACCGACTACAGTTTTACACCGTTCCTGGCCACCACCATCCTCTCCATCGTCTTCATCTACTTCAT
GGTCCCGGAGACGTCGGACTTGACGATCGCTGAGATCCAGAATGGCTTCCGTGGCGAGCAAAACCTCCACTCGGTCAAGAGTCAGCAGTA