Description :
From Genome Similarity Track
Location :
Scaffold_183:13890- 16157
Sequence
2267 bases(100 bases per row)
TGCACGCATCAATTGGCCGCTCATCGCCTGTACAAGACCCTGAGAACCACCGCAGGTGCGTACACCACCCCGAGGCTTTCGTCCTGCAACTCCGCGAGCT
CACCCACTTCGAAGTCACCTCCGGTTCTCGTGGCTTTGTACAGTGCACGGCTCAGCAACCGAGGCCTCACCATCATCCACTTCTGCCCTCTCACAGAGAT
GGAACAGCTTCGACGGGGGCCGATTTATGTAAACTTTGCAGAGCAGACTTTGGAGCCGCAGCTGTGTTACCAACTACCATGTCGCAGTGCGACACATACG
ACGATCTGAGGCGAGGCCGATGAAACCTTTATCTCCCAGGGGGGGATTCGTATAGCGCAGCCCAAGACTGTTCCCCAGGGGTAGACCCAGAGAATCGACT
TGAGAGTCAACAGCAAGAAGATAGACCCAGAAATTTGCAGCCGCAAAGCTTTAAACCCTGAAAATCACACTCCTTGGTTGGCGTGGGTACCTTGTGTAAT
CCCTGTCGGCTCGTTTGTCTTCGACGGAACGGCACTCCACCGGTTGTAAATGTAGCCTCGAAGAAGTGCGGGAGCGCACATCTACTTCAGAACGCACCTC
CACACCAAAAGGCAAACCCAGAGAATCAGATCCCCTGAAACCCAGAATATCACGAATTCAGGGTCCAGGATTTCAGTCAACTCTGGGACTTGGAACTCAG
AAGACACCTTACCCAAATACCCTCCTAGCTCGATAAAACCAACAAATACAGAGTATACAAACACTACAACTATCCGTCATTTATTCTTTTGGACCCTTGG
ACGGTGGGTCACACACACACTAGGCTCACTCGAGTCTGAAATTCAGGGGCCTAGCTCCCCTGAGACTCACACAAACGTGCACCACCTCCAATAAAGGAGG
AAAATACAGTCACTATCAGTTACCTTCCCTTCACACAAGCAGTCAATACAAAATCCTGGAGGCGACTACCTAGCACCCCAGAATACCCTCTGGAATAATA
TGAAATGGGCTACCACGAGCACAGCAAGTGACCCAACTAGGATATGGAATAGATGGATCACCCCAGGAAGCTCAAGGCCGTCGCTGGTCACCACCTAACT
GGACTTGAGTTTGATTGAGCCCACACAGACGGCTGTCCTTCGCCGTTGATGTGCCCTTAGCGTCCCGCGGTCGTGGTCTCGGGTCCTCCGGATTTCCGTC
GGCAGGCTTGGCCGAAGTCACTTGCGCAGTACAGGGTAAAAGGAGCTCTGTTTGGTTTTTATCAGCTACTTCTCTCTCTCTTCTTCGGGCAAATATCTTC
TGTTCACTGTGCTTGGGGTCAAATGTCTTGTCTTGAGTATACCTTGGGTTCAGCGGTCCAAAGTTGCGATCGACTTGCGATTCCATTGTCGCACGGCGTC
GAAAGTGCCAATTGTGGGTCCTTGGACTTGGTTTAGTATGGTGCAGGACTCCCTCTCGACTCCTCGAAAGTATCCAGTCTGCGCATCCATAGCGGTTCTT
CAAGGTCACGCATCACTTTGCTTGCAGACTGACTTCGAACTGACTCGAATCCATGAAAATCATGTGACACTCAGGGTCATCTTCTGAAATCCTGGGGAAT
TCTGAGGAATCTTTGGGGAACTGTGGGGATTCTTGGATGTTGGCTTGGGAAACACTTAAGTTCAGTATGGAGAGTCTGGATTCTTGATCCAAACCCAGAG
AATCATCTGGTCACCTGCACTCAGGGGGGTGAACTCTGGGTCATCGTGCGGCACTCTGGGTTTCCGTGCGGCACTCTGGGTAACAAGTCTGCTACATTGC
AGGCTCGCGTGTATCTCCACAAAGCCACACTTTTAGCGGGTTTAGCGGCCTCCTGCGCATGATCATGGTGGTAGTGGGTTGATTCTCAGGGTAATTTGAT
CCTCTGGGGCACTCTGAGCCACAGCAAGATGAGGTGTACTCTGGGATGCATTCGCCAGAGACACTTTCCGCCAGACTTTAGGCACTCATCGTAAGGGAAA
GTCCGCGGCTGGACTGAGTGTACTTTGACATCCTGGGTGTGCACTCCCAGGATTCACACTTCCAGCCAGTTGGGCCCATCTGCGGTCAGGTACTGGATTC
ATTCCACAGCATCACTTTTCTCCCACAATCGTCACTCGTGTCACACGGGTACAGCCACGCCGCACCCATTTCATCCGCCACTTGTCGTCCAATACAAGCT
CCAATTCATTTCTAGAATGGCATGTCGTCGACGAAAAACTGAGAACCGCCTCGTGTCAGATCTCCTG