Description :
From Genome Similarity Track
Location :
Scaffold_2490:1389- 3746
Transcript NameFunction/comments
Phyta_totarag14545hypothetical protein

Sequence
2357 bases(100 bases per row)
AGAACGAATGGtacagacgacgacgagagcttTGAAGATGTTCGTTCAGGATCTAGATCAACGAGATTGAGATGAGTATACGGAGCGACTGATGTTCGCG
ATCAACACAGCTCAAGATCGGGTTCGTGGAGATACACCCTTCTATCTGGTGCACGGATAGGATCCGCGATCGACACTCAAGGCGACTATACCATTGGGGT
GCACCCGAACACAGGATCGCGATCCCCGGAGGTGGCGATATCGGATCCAACGACACTTCACGCAAGCCCGAGAACAGGTTAATGACCGACTGCGAGACGT
GATCTCGGATCGAGCCCATCGGCACAACGAAGGAGTTTGATCGAGGCTGCATCTCAAGTATGGCTATATCTGGATCGAGTGAAGGAAGGCTACGCCCAGA
AGTTAGCCCATCTGTGGCATGGCCCTTTTCGCGTTGCGGAGAAGGTCAACGAGTACACCATGCGACTTCAGACTGATGCGACCGAGTATCGTCTATTCCT
GGTTGTTCATGTGTCGAAGTCAAAGCCAGTTAGGGAATTCCCGGATCGGCCGCAGATCGAGTTGACCGTAGACGAAGCCGATCGGTTAGATTTCGACGAG
ATCTTACTTCCCGAGGATAGCTGGGTCATAGATCTGGGTGTGAATGaatacgaagtggagaagatcaccAACATGGGGACTGGTAAACGGACGCGGTACG
GCCGAACCTATCGAGAGTTCCTAGTGCACTGGAAGGACTACGACGATCCCAGCTGGGTTGACGAAGCTGACCTCAACtgagcgctgctgcacgagtaTGT
TCGAGATCGTGCGAGCCGAAATCGGTTTGGCGCGATGCAATCTCACTAGGAGGAGTGAGATCGGACCACCAAGGTGAGATGGTCACCTTGGTGAGGGAGT
TGGATGATGGATCTACGGGGAGGCCGTAGATCGGAGGAAGGGTTAGATGTGTGTGAGTATGTATACCAAGGCAAATTTTGGCGAAAACATCTCCCCCTAA
TTTCAGATCCAATCTGAAATAGTCCCTTCGGGTATTtgtgttcgacttgggtcGAAATAGCTGACTGCTTATATTTTCGGAACCAAACCAGCAATTTAGT
CCACAACCCAGTTATttcgaacacggccttagTTTTACATGCACACAAAAATTGTGTTTAATACTATGAGACGTAAATGTCGTCAATCGCGTGATCTTCT
CGTGGCCATGATGTTGACGCTCGTGCGCATCCTGTAGTCATTGTATGAGTCTCGTGCATACCATTATCACACAGCTTACAAAGAAAATCCGACGCAGATG
CCCAAAAATGCATCATTGGATTGGGTGTGTGTACAATGCGAAGTCGTTACAGCTTGATCTCATAATACCCTATTGCTGCCTCATTTTTAGTCCAAAACCG
GCTCGAACATTTTGGAGTCGCTTTGCGAGAAATGGTAACTCACTCTGCACATTTGCACAGCCCCGTTTGTTGGGAGGCTTAAGAGCTATCTAGCGCACTA
ATTGGCTAAACAATTCGTTAGTTAACTGTGACCTCCACTTCCATGGGCCGCTCGGTGGAGCCCCGACTTCAAACATGTAGTCTCCCTCGTCCAAAACGCT
TTTTGGAAAGCACAATCTATTCTAGTTTGTATGCACCATTATCTGAGGAATGTAAGAGATGGGTCCCATTGTCAATTGCATTGTTCGTTCTGGTTGTGAG
CGGTTGTGAGCGACCATGAAGCAGGGCCGCGCGGTGTTTGCGAAAGTGGGTCCAGCGCCGAGCGTTCCAGCGACCGCATCCGTTGCCGTGACTCAGCGGT
AGCTTTTCAATTGCGGGGGTCTGGAGAACACTAACATCCTGTTCGGCCTATGACCAGCAACTCAATAAACCTCTACCtcataaaaaaataaataatgGAG
AGAGAACACTAACCCCCCTTCCCCGCGCTCTCTCTCTTCATTAGCTGTAGTCTACAGCAGTCTGCAAAGTCACAGAGGATCAAAGGCTTTTTTCATATCC
CAAGTTACGTTACCCAACCAGGACTTCAGCAGAGACATCCGGTCGCAGCCTTTATCATGGCTTTGAACAGCAACTACCATGGTACATTTAtaaatattaa
tacatgtattatttATTATGTTTTGCAGTCTTTTTGGCACAAACGGTTGTAATTCGTACGATTTAACTTCTCCAATAAATACATAAATCGTACTCGAGTA
CGAATTAGTGTAAATCGTGAATGCTATCTTCGCTAATAGTGTGCACAAGTATTTTGGACATGGTCTGGTACATCGAATACGATTAAGCATCTGTTTGGCA
CTTCTATAAAGTGCCATTTGAAAGCTATAATGTGCTTGAAACACGATTTGAAGTACG