Description :
From Genome Similarity Track
Location :
Scaffold_21:138894- 140312
Sequence
1418 bases(100 bases per row)
AACTACCACCGGACAGAAACAGCATGAGATCAATCTCGTGTCTGGCACAAAGAACTGTGTCACGGGACGATGGCCCCGCCACACAAGCTGTGCGAGGTCA
TTGATGCCTTCTTCGCTGCGAAAGCATGAGATCAATCTCGTGTCTGGCACAAAGAACTGTGTCACGGGACGATGGCCCCGCCACACAAGCTGTGCGAGGT
CATTGATGCCTTCTTCGCTGCGAAAGTGAAGGCAGGCATGGAGCGGGAGTCAAAGGCCCCGCACTCGACTCCAACTTACTGCGCTCGGAAATCGAACAGA
AAGTGGCGTCTGGTTCATACTTATAACAAAGGGAACAACGCGACGGTGCCGGATCAGCCAACAATCCTACGAAAGGATGTGTTGCTGAACAACACGGCCG
AATACGTACTGTACAGTACGCCGGATTTAGGAGACGGATACTACCAGAATATGATGCGCGAGAACGACATTCCGCTCACGTGGTAAGCACTACAAACGGC
ATGCTTTGGGAGTGGCTCGTCATGCCGCAGGACCTGTCTAACGCCGCGGAGACAATCAACGGCCTGGTGACGCAGCTGTTCAGGCTAGTGCGTGCCTCGT
ACACACGCACTTCGACGACATCTTCGTCCATATCCGTACCGAGAGAGACAAAACGGCCATGGAGGTGCATTTGGGGCACCTCCGTCGAGTGTTGGATGTG
ATGAGAGCGAACAAGCTCTAGGCCAACATCGACAAGTGCGGCTTCGCGTCGCCAAAGCTCAAGGTTCTCGGTTGCTTCGTCAACAACGTCGGCGTTTGCG
CTGACCCAGACAAGGCCAAGGCCATTGTAGCATGACTGGCGCCCCGATACCAGAAGGATCTCCGAAAGTGATTGGGCTTGACCAACTGCCTTCACAAGTA
CATCGCAAGGTACACGGGCCTCGCTACTCCCCTGTCGGGCCTCCATCAGAAGGACGCCGACTGACGCTGGGACCGAGAGCACAAGGATACCTTTGACAGC
GTCGAGACCAGTCTCCAAGAGACTCCTCAGAAGATGTACCCGAAACTTCACGAGGGCATATATCATTGCCAGGAGCTCCTTGTCGTGAGCAGGGTAGTTC
CGCTCGGCGGCTTTGAGCTGCCTGGACTGGAACGCGATGACTCGCTCGTATCCAGCTGCATCGGCCTGCAGCAATGCCCTACAGATTGCCTAGTCGGAGG
CATTGCAGACGATGCTGAACAGCTTCGTCTCGTCCGGCAGGGCTAGGACACTTTGGGATCTACACAGACCACGCATCCTAGCGAACGGCGACGAAGGCGT
CTCACCTCTCCCAATAGATGCTGAGGTGGATGTCCTTCTTTGCGGCCGCGTTGCGTAGAAGACGAGCAAACTTAACGTGCTTGCGGACGCCTTATGTCGG
CGTCCGGACAACGCGTTG