Description :
From Genome Similarity Track
Location :
Scaffold_119:138892- 140617
Transcript NameFunction/comments
g9541.t1RAW39515.1 hypothetical protein PC110_g4244 [Phytophthora cactorum

Sequence
1725 bases(100 bases per row)
TGATTCACGTTGAACAGCTCCGACAGACGTTCCATGGGCAGATCGCACTCAACACTGCCGTCACTCCACTTGAGCCCCTCGCGGTAGTAGGGAACAATAT
TCCCATTCTCATCCTTGGCCAGCAGCTCGACGGGACGGAACAAGTTCGGAATCGCACACGACGCAAGAGAGGCCGACCAAATGATCACGTTCGGGGCGGT
AAGATAGTTGAGCAGTTGAGGATAATCGTCAGCGCTCAGTGGGGTCACCGTGATGTTGATGATCCGACCCGTCCTATCGTAGGCTTCCCTGAAAGTGTAG
TCACCCATGGCATTTCGCAAGCAGTCACGCAGAGTCTTCGTGTCCAATACAAAGCGTTTGTCCAAGAACCGGTTGAGAAGGATGAACGCATCTCGCACAA
GTTCGAACCCACCCGTCGGTAGCAATACTTGCGCCGGGGACAGGAACGACGGCGTATACTCCACCCGGTCCTGCTCTGTAATGTTTGGTCCCAAGAAATT
CAGGTTCACATTTTCGCCCGTCAAGAACTCCAGCACCTCGTCATCATTGCGCACGCCTATCGCTCCCGCCAGGATCGATCCCGCTGAAGACCCAGCAATA
ACATTGGGCAGCAGATTGTTCTCCGCCAACGCCTTGATCACTCCAGCGTGGTAAAATCCATGTGCTCCGCCACCCGACAGCATCAACGCAGACCGTCCGA
ACGCGTGGCGCGTTTCACTGAAGAATGCAAGCTTATTGTCAATCGACAACTCGTTGTCCTCTTCGTCCGTTCCTTTGGCCCGCAGCACCACGTTCATCGA
CTGCACGATCGTGTCGAGATACTCCTCAATCACGTGCTTGGTCCCCACTGCCAAATTAACACAAAATCTACGTCAGTACATGTAACTCCGTCTCCATAGC
TCATCAGCCTTCGTACCGTTGCTGACTTGGTACAGTCTTGGGTTGCCAAGTCCCCAGTGCTTTCTGAGCAGCCCCGCTCGCAGCGCGAACATAAGGCCCA
TGACGTCGTTCTCGAGTTTCAATCTCTTGTACACCTGCGTCTTGTTTAGCACTCGTTCGTACAGGAAGAGTCCGGACGCCGGGTCTTCGCGCCACTTGTC
CTTACCCTCGAGTTTGTCCAGTTCCCCGGCGATGGACTGTCGTTCCTGGAAGCTCTTGACGTTCTGTAGCTGCTGTCTCAGTCTCAACGTGCGTCTTCCC
TTGGCTGTGAGCCTCAGAAACGTGCCGCCCAGCACGTGGCGAGCGACCGACTGCAGCTCGTACACAATGTGCAGCACGAAGGTGGCGCACAGATAGCGCG
CGAAGACGTCGGGTACCAGCACCACACGCAGCGTGCGCAGCCACAGCTCCACGAGCGTCATGGTGAGGTGGTGCACGAACGCGTGCTTCTCGGTAGCTGT
GCGACACACGCGGTGCTTTAGCTGCTGCACGATGCGCCACACGAGCTGCTCATGCTTCTCCAGCCCTGTGGCGAAGATCCAGAATCGCGCCCACAGGTGC
AGCAGCGAGAGCGCACGCTCTTGCAGCCGCACAAGCGACGTCTGGTGCGGTGTCACGGTCAGCGTCCGGCTCGTGGATAGCGCGGCACCCATCGGTCCGT
TTCCTCCTAATGCGGAATGGTCAAAAGGCAACGTCTCCCCTACTTACTGTGACCATCACTCTGACGCGATACTGGGGACAAGTTATTTGTGAGCTTCAAC
ATGGCCACATCAGGTTCTTCAGTTT