Description :
From Genome Similarity Track
Location :
Scaffold_310:13886- 15429
Sequence
1543 bases(100 bases per row)
ACCGCAAGATCTTCCTTGGGGATGGCAATGCTGCGCGGCCCCAGCCAGGGGCGTGGTGTGTGACCTGGATGTGGGTGACGCAAAACCCGTTGCTCAACGA
CCAAGGTCCATTGCCCCTCACTTGATGATGAAGGTGTACGAGCTCCTGAAGAAGCTGCTGGAAACGGGTCTGATTGAGATGTCGCTGTCGCCATGGGCTT
CCACGATTGTGATCGTCCTCAAGAAGGATGGCGTGGACATCCGAATGTGCATCGACTATCGAGTGGTTAATGGGTTCATCCGGCTTTCTAGCTACCCGTT
GCCCCTGATCGATGATCTCCTGATTGGATTCGAAGCCGCTATGTGGTTCATGAGTCTGGACATGGCGAGCGGGTTCTGGGCGGTCCGGATGACGGAACGT
GCGAAGCTAATCTCCGCGTTCATCTGCCCATTCGGACACTTCCAGTGGGTACGCATGCCATTTGGGCTCAAGAATGCCCCACTCGTATATCAGGCGGTGA
TCAACAACTGCCTTTGGGGTTCGTGCGTCTCCCTCGGGAAGAAGAAGAACAGGTGGACCCAGATGTACTCGAGTTCCTCGGTTTGGACCCGTCCGTCCGG
GATGAATCCGAACGGGAGAAGGCTGGAGCTAGTGTTCCCGTCCTGGTGGAACGGATGACTGTGTTTCAACGCAACATCCCGATGCTGTCCCAGATGGGAC
CTGTCCTCGGACGGAGTTCCTACATCGATGACATTGCGCATGGGGCGCCCACCTGGGATCAGTTGTGTGAGGACCTGAATGCGCTGCTATTCCGGTTGAG
CTATTGGAACATCTCTGTCCGCCCGCCCAAGAGTGAGTTCGGGAAGTTGAGTATCCCGAATCTCTCCCACGAGATCAGTGCCGAAGGACTGCGCGCGACT
CCGAAGATTGCGAAGGGTGTTCAGGATCTGCCGTTCCCGTCTACCTGAAGGGAGTTCAGTCATTCCTCGGAAGCCTCAACTACTATCACAAGTTCATTGA
GGACTTCCCGGTTGTGGCTGCAGTCCTGTATGAGCTCACGGAGGATCAAGTGAAGTCCGGCCGGGATCTGTCCAGGGCGAAGGAGGCATTCGAGATCTTG
AAACGGAAGATCGTGTCGCCACCCCTGTTGCGACACCCCAACCGGACCAAGCCATTCGTGATTATCCCGCATGCTAACCGCTGGGCCGTTTGCGCGGTCC
TCGGCCAGGAGTATGATGGAGTGATCCATCCTGTGAGGTTCACGGGGCGCGTACTGAACGACGCGGAGATTCGATACCACATCGCCGAGAAGGAGGCAGT
TGCTGTCATGCGAGTTCTGGATGTGTTTAACACTCTCGTCCAGGGTTGCCCGATCAAGGTGTACACCAGGTATTCAGTACTGTCCTGGCTGTTGAAGTCT
AAGACCGCCGACGGCCGACATGTCCGGTGGGGTTAACACTATCCCATTGGGACTTGGAAGTGCAGAAGGTGAAGCGAGACGAAGACGGCCTGGCCGCGAT
CCTGGGCGCTGGCATAACGCCGCGTGAGCACCTGGACGAGGTG