Description :
From Genome Similarity Track
Location :
contig_69:13885- 15032
Transcript NameFunction/comments
g9864.t1hypothetical protein

Sequence
1147 bases(100 bases per row)
ATGGAACGGGTTTCCCGTTCTCAACCTCACAAGTACAACGCGCCAATTGGGGTACTGGGTCGGCACCACACCAGCAGTTACAGAAAACCGGGAGATTCGA
AAAGAGAAAATTCAGCGCAGAATATGGATAGCAACCACGATCAGCATCACGGTGGTCCAGCGTGTGGAACTGTTCAATGCAGTGGCACTACCCGCTATTT
TATATACAGGAAAAACAGTTTGTACCGACGAAGCAGATACTTCGACGACTACAAAACCTTCAGCATTCATATGGAAAGGACAGACGAGCACTGCAGCGAT
GAAGAATAAGTTTAAGTTTGCATGTATGTTTACCCCACGCCAACGAGGAGGACTTGAACTTCAAGACGTCAAATGGTAACCCGAAGCAACCTTGCGGAGA
GGTGGCTTCAAGAAGAACCCGACCTTTATTCGGTAGCACGGCACTCAACAGTACATCCATACGAATCTATGAGTTCAGGATACTGCTCGTTCCAGCCAAC
TAGCCAAACAATGATTGAGTCAATTTTGCGAGAGAAGCGTGCGTGAAAGCTAACGACAAATGTCCAACAATCGGGCAAATGTGAACTGTGGTGGGCACAG
TCGGAGCGATTACTACCCAGTGAAAAGCAGAAACAATTATTTCAGCTAGAAGCTGAAAGCTCCCGGCCGTTTCTAAAGCACCGTACTTCAGCTTGCAGAC
TTTCTGGGGTGTTTTAAAACCATTATTGCAAAAACCGGCGGTGACTACACGTGTTTTGTACGGATGTGTTCCAAATCGCTTCTTTCAGTCACTTGGATTT
TGTAAATAGCAAGCTCGTATGGGACGATCCCTCAAATGTGTGAATGTGGTCAAATCCCCCCCCCCTATCACTCGAAAAGTTATCCAATGGAAGCCAACCA
CTAGGGGTGGAACTTCACGGTAGTTTCCTGAGCAGAAGTAAGGGTGGTAAGGCGGCCTTCTATTTTGTAACCGGGTACACCGACGTGTACCCATGTTACA
TAAAGAGTGACGGGATGTCTCTCTTTGTGCCCATGGTACGTGGTACCGGTTGGCGGTGAGCCAACCATTGGGCACTTGTTTAGCTTTTACTATAGTTGAC
TTAGAGTTTGTAAGGATCAAGCTTGACTCACCTATAATATATATTCA