Description :
From Genome Similarity Track
Location :
Scaffold_15:138845- 145506
Transcript NameFunction/comments
Phymu_g1095callose synthase, putative

Sequence
6661 bases(100 bases per row)
TCTACGGCGCGCTGCCAGCGGGCGACTCGTACATCTGGTAGTTCGAGTGCGACTTTGCGCGCGAACGGCTGAAGTTCCTGGAGCGCGCGCTGCCGGGCGT
GCGGGCGCTGCGACGGGATGCCCGGATGCGACGCAGACGCGCGCGTTCGGCCTCCATCTCGCCCTTGGTGCACACCATGCCGTTCTTGAGGGTTCCCACC
GTGAAGAGaagcgccgtcgccaccacACAGCAGCCAGTTAAAGCGAACAGGTAGATGTACTGGTCACCGCTCATCGACTCGTTCGAGCGGATGTACGTGG
CACACACAGGCAACAGGAAGAACACCATGAAGTAGACGGTCACGTACACTGCGCGCTGCTTCGTGGTGAACAGACCGACGCACGACACCCAAGGCACGGA
CGTAATGCCCAGACCAGCGAAGAAGTAGAGCAACAAACCCAcgatctgcagcagcaagtactTGCTGTCGCCCGTCACGAACTCCGACTTGTCGTTCAGT
CCGAGAACGAACACTAGTCCGGCCATGGGCAACAACGTGCAGAACAGAATGCGCTTGTGGTCGATGCggtccatgaagaagaacgagaagagcgcGCCCA
GGAACTGCAAGCCCATGCAGTTCACGAACATGTAGGTCGCGTCCTCGATGCTGCGGAACGTGTCCGACAGGTACATGTTGACACAGCCCAGGAAGATACT
CGAGACGAGCATCAGGAACAGTCCCATCATGAACTTGAGGAACGACGTGCCGCCGTTGGCGCTCGAGTCGTCGCTTccagcctcttcgtcgcgGATCATA
CGCAGCTCCTCCGACACCCCCTCCTTACGACGCAGAACAGCCAGACAACGCTCGCACGACTCCAGACCTTCGCGCATGTACACCCAGTACGGGCTCTCCG
GGAAGATGTAAACTGCCGGGGTCATGATCGACAGGATGATAGTCGCAATGAACACCTGCCACACCCAGCCGACCTcgttcgacgacgaggagaaccAGGC
AGCGAACAAGATGCCCAAGATGAAACCACTGCCAAGAAGCAACAGCGCCTTGCCGCGCATGTCACGGGTCGAAATCTCGTAGATGTACACAGCCAAGGTA
GGCAGAAGCATGCCCACAGAGCCACCAAGCAAGCAAATGCCAGGCATCAGGAAGCCTTCACCACCGGTCTGCACCGCGCTCACGCCCAGCATACCAAGAA
CAGTCAATAACCCGCCGAAGACGATCGACAGTCGGCGGCCGATGAAGTAGTTCAGAAAACCGGCCACGAACGTACCCACCATGCTGGCGAAGTAGAACGC
GTACGTCACTGAGCCGTCCCCGACGTTACCGTCCAGCAGGTCGTACGTCGTGACGTAACTCAGGAAACCAGCCGTGCTCTCAAGAGTAGTGAACAAGTGG
AACAGCCAACCGCAGCCCATGCCGCCCAGCACACCCATGAAGGCGGCGAGCGAGAAGGCGTACTGCGACGAAGCCGAGACGACTTCCGAGAAGCCCTTGT
TGTACATCATACGTGTCTGGATAATGTTCAGGAACGGGATCGCCGACATGACGAGAAGCGGGGCGATCATGGCCACTGCGAACACAAAGTCAAAGAAGAA
CGCCAACTGTTGGAACATGCCAACAGTAGCGATCCCCGAGTTCGCGAAGCTGTACATGCGCGCCATCTCGTTGATTCCGTACAGAGCAGCCATGTAGCCG
AAGAACAGAGAGATCGTACGGGTAAAGCTCAAGTCAGAGATGACGAGCGTGACCACGAAGAACGCGATtagcgccaccaccaccataAACGTGTACAGGA
TCGCGCGGGTCGACGCCTTCATGTTGCGCATAGTAGCGCCGACAGCTCCAAAGAGACCCATGGCCAGAACTGTGACCACGGAGGCGCCAAACACCAGACC
GACCGTCAGGATCTCCCACTCGAGAGCCACCACGTACCACATGAGCAGGAAGTGACGGCATTCACGCAGAATGACTGTAAAGCGAGCAATAGGCTTCGTG
TTGTGGTACAGCTTGAGCTCGCCCTTCCACCAGCCAATCCATCCGCCAACCATCACCGTGTCTTCATCCTTGTAGTCCTCGGCAGCGTACATCCACTTGG
CCCAGGCCGTCACATCGGCCTTGGTCTTCTCCCAATCGAGTCCGTCCGTGTTGAAGATGTACGGGGACACCAGCCACACCACAGCGATCACCCAGATAGC
GAACGTCTGCACACCGAAGCTCTGCGACGTCTCACAGTAGTCAAAGGCGAACGAATTCGTCTCACCGGCCACTGAAGTATCACAAATGTCAAACTTGCCG
AACGACAAGTACACCAGACACAGTCCAACGAGCTCCATAGCCTTGCGGTAGTGACTGTTAGCGTACGCCTtgtacagcagcacaaacGTCTCACGCGTGA
TCTTAAATCCACGCCCCGTAGCCTTGTACTGCGCCTCGCCGTGCAGCAAgttgttgtcgaagaagtgCATGGTCGTTCCAAGCTGGAAAATGAAGAAGGC
CGGACCCAGAGTGCACACCATCTCCAAGAACTGCACGAGACCGCGACGAAGACCCATTTCAGCAAAGTACACACAGATCAACGGCAGCGACAGGAACAGA
CCAGCCTGGATGTAGTACTGCGTGTTGTACACTGAGTCCATGTCGGAGTACACGCGGTCGTCGAAGCCGTAGTCGAACGAGTTGTCCATGATGATCTCCG
TCGTGTTCATGTTGTACACAATCTGCGTCTGCACGCCCGACAGAGCGATGTAGACtttgcagtacatgtacacgaacgTCGTGACGATCGTCATCCACGT
CGCGTAGTAGAATCCAGTGTGCGAGTAGTACATCGAGTTCAAGCGGAAGAAGTCCATGAACTGACCCATACGGTGAGCTTCACGCGCCAGCGAAGTTTCA
CCGGCACCGTTGGCCAATTTACCTTCGAACATCGAAATCTGCGACAGAGCCACATCACGACCCTTACCACACTGCATGAACTCCACGTGGGTCACCACTC
CACCGCGCAGGGTGCAGTTGAAACCGGCGAAAACATCCTCAGACAGGTTAATGCCCTTGGAAGCCTTGGACACACCGCCACGCGTGAtagccagcacctt
gtcgaaCACATCGGGGTGGCCGTAGTGCATACGCACGTACAGAGGGTCAGCAAGGACACGTTGGGACAGCGTGACGAAcaccagctcctgccacGTCTTG
AACTTTGCCAGAGAACTGGCGTTACCCGTGAAAATGTGCTCACGCATGCCAATAATGGACACAGGCTTCTTAGACGGGTGCAGGTCGGCTGTGCACAGGA
GCTGCGGCATCTTCAGACACTCCTCGAAgtagtgctgctggttcatATCGATCGTCTGGACGAACTCGCCACGCGTGAACGGGATGGCGTTGTTCTGGTT
CTCGGGCTTACCTTCACCCAGAATCGGGTCGCCAGGGAGGGAGTAGCGGTACACTTCCACAATCTCGTCGGATTCGCTCTTGATCAGCACAGTGTCGAAC
GACTTCTCTCCATCTTCGTTCTCCACCGTGTCCACATAAGCAACACGCAGGTTCGGGTACTCGCGCAGTAGGTAGTCAATGTCCGCGGCCTGGGCTTTAC
CTTCCAGGCGGTGCTTTCCGTACACCTGACAGGCGCAAATGTACGAAAATTTCAGACGGACCATGTCCTGCAgctggttctgcttctgctctcCGGACTT
GCCAGGACTTGAGCCAATTTCCAACCAGTGCAAGATCTTGATCGCATCCTCGTACATCATCATGCCCTGCACGGTACGAGCCAGAGTCTGGCCACGGTAC
GACGCCCAGAGACGGATCTCCTCGGGGTGGTTCTTCTGGGCCTCCTCGGCGGAACTCACATCCACACGCTCCAAGAAGTTGTCCCATTCTTCCTGGTGGA
TCTTCGTCAAGTACTTGAGAATCGTCAGGTTCTTGCCATCTTCCTCCACCTGTTGGAAGATCGGGTGGTTCACAAGCGGGTCGTTCAGGTCCTTGAGCGA
GAACAGCACCGTTTCAGCGTAGAACGGAGTCACAACAGAGAAGCTGCGCATCTCCTTGATGGAGCGCAGCTGAGGGATGTCCATGACAAGCGACTTCATG
AAGAAACCGAGACGACGCTGGGCCTCCGTCGTACGGGGCATCGCCTCCGACCGGtccagagacagcagcagacaggCACGCGTAGCAGCACCCATGGCCG
TATCACTGCAGAACAGGTTCACAAGGCCACGGGAAGCGAACATGTATCCGTtagcgctggagcagaactTGGAGTTGCCAAACTTCCGCTGAAGAGCAGG
GTCCACGCAGAACGACTGCACGCCGTTCAGGAACGCCTCCATCTTGGAGACGAAGTTGCGAATCACACCCATCGAGTGCACACGAGCGTTCGGGATGTGT
TGCGACTGCACGTCCGGGTCCGGCAGGTCCAAGATCTCTTCCAGAAGGTCAACGGCAGCAACACGAAGACTGGCCAGTTCACGCACGTTGAACGACTTGA
GGAAGCCGCCGCTAGAAGCGATCTCCTCGAGCATACGGAAACCGTCGACcacatcagcgtcgtcattGCCGAACAGAGCACTGACAACGTACATGCTGGC
AGTGAAGAACGAGCGGATCGCCGAGAGGCAGTCGTTCTCCACAAGTGTCACACGCAGCTGAGACTCGCCCTTGCCGTCCTTAGCCGTCTTGATAGCCAGG
CTCATAGCCTCCGTCAGCTTACCAGCCGACAGGAACACAGGTTCGAACACCTCACCGGTACTGCGGATGTCGTACTGAAGAATAGCAGCctccttgtcgt
ccagcaaaTCGCCCTCACGGAACGAGTTCACGATCTCATTCCACACCACAACGAAGCGCAGCATCATCTGCGATTCGTACGCAGCAGCCAAGGCGCTGGC
ACGGGTGGAGTCAGTTCCACTGGCAGTGGCGTCGCTTGAGCGAGCGAGAAGCGTCACAACCTTCTGGTCGAACAACTGAGGAGCGACACGGAAAGCCTTG
GTCATTTCCTTGGCCCCTCGGATCTCGCCCGTCTTCATGAGAATACCCTGGAATCCACCGAGCAGAGCCTGGAAGATCGTGAAGTAAATCTGCGTAGCGT
AGTTGAAAATGAACACCACGGGCAGCCACAGAGCGATGATAATGCCAACGTTGTGGAACGACACCAGAGAGTTCTGGTATTCCAGCGTCATGGCGTAAAT
GCTCAACGTCGGAAGCATCAGCGGACGAACCAGAATGAAGTACGACGTGATGGCTTCGACGATCCACAGCAGGATCCAGAACAAAATGTACTTGACTTGG
TACGAGAACGGAGGCGTCATGTCCTGGCCGACGTAGCAGCTTTCCCCCTCACGAACAAACTTGGCTGCAAACGTTCCGTTAATGACCTGAGGCGCGAACG
CCTGtgtgagcagcacaagcagacCAGGCAGGATGTAGGCACCGCAGAGCGGGTACAAATTGTCCAGCAGTGTCGTGTCCTTGTCTTCATTCATAGGCAC
GTAGATCATGATTCCGAACAGAACGGCAAAGCCTCCGTTCCAGATGATTCGGGTGGCCAGAGCCGTTCCGTACGTGAACGAGCGCGAACTAGTGGCCGAA
CTCTCCTTGGACGTCAACAAGTGCCATCCGTGGCAAACTTCCATGACACATTTGCAAAACGCCATCAGACTCAGACTGAGCGGGATGGAAACAACGGCAA
TTTTCAAGTCCCGAGTGGTGTACGGCTCCACCACGTCACCGATCCGTCCGAATTGCACCCATCCGCTTTTACCACCGTCTGGCGAAATGGTAACGGCAAA
AGCCAAGACCGAaagcagcaccaggaacATGATGTTAAACTGGAAAATGCGGTAGTAGTTGAGCACCAACGTGAAAATGCTTCGGTGTTCGTAGAACGTC
TTGCCGTGGTTTTGCGTCAGTTCCTGGCCCACGTGAGCCACAGGGATGCTGAGACAGTGCTGTTTCCAAAAGTACtcgttgatgtcgtcgtAATTTCGGA
TTTTCACGTGTTCCAAAGGTTTGCCAAGCGCGTTACGACGCTTCATGTTGCTGGCTTCTCTCCAAATGGGGCGGATCACTTGCTCCAGGTACCAGCCTTC
GGGTTGCCGCTCGTGGCCTTGCGGGTCGGCGTTCACCATTGTCAGCATCTGGTGGAAAAGGTAGCATACACATTCTGGCATGTGCCGGACGTTGGCCGCT
TCTCCCCAAATAAGGAAATACAACATGACGTCCATGTGCATATTGCCGGAAGGTGTAGAGTGCGGAATGCCACTTCCAGTGTACGTCACGGGGTTCGTGT
GGATAAATTTGCACCACGAGCGGTAGTTGGTGAAAAGCTTGTTGGCAAGCTGCACCAGGTGCTGGTCAGCTGCGTCGCTCGGCAAACAGCGCGCCTTGCC
GTTCGCCAAAAGAAGTAGCACGTGCTCGCGCTGGTTGCTCGCCGATCCTTCCTGGAATCCGAATTTAGCCTTGAGGAATTCGCAGCAGTAATCAATGgcc
gcttcgtcgtccgtgGACGCGCCTTTGAAGCTCGCGGGCGTCACATCCATCGTGTTCAAGCGCTGGCTGAAGCGCTCGGAGCGCTCCGACTTGTTGCGGC
GTCGATCAGCATCCAACTCGAAGTAGTTGGAGCTGGCACGCCGGCGTCGGTCCATCTCGCC