Description :
From Genome Similarity Track
Location :
scaffold_402:1388- 10399
Transcript NameFunction/comments
g8034.t1 hypothetical protein PHYSODRAFT_547717

Sequence
9011 bases(100 bases per row)
GATAAGAGCAACGCCCGCAAGAACCCAGCGCGCAGGTGGCGACTTGGACTTGAGTTGCGCCGAGAAGACGTACGTTGGCCCACGGAACTCCGTCTTGTAG
CATGGACAGACGAAAGAACCCTTGACGTCGAGCTTGTCAGCAGCCACAGCCTTGCAATTGATGACAGGCATGGGCGAAAACATTTCCTTGGGATGGGACC
GATCCACCGTGTTGTTCTGGATGTCCCAACGCGCACCCATGAGGAAAAGGCCGTGGATGTAGGCTCCGTCCCGAGATGGAGCGTCCACTTCTCCGTTGCG
ACGCTTAAGCACGTCCGTCTGGATCACGAGCTTGTCGAGTTCCCACTGGTTCTTCTGGGCCGTGACCTGCATGATAGCCGTCAAGAACGACTGCGGGTTG
ATCATACCAGACAGCCACGTTACACGTGGGATATCGGCCGGATTCTGCGTCCATTCCTCCAGTTGTTGCAGTCGAGCTTCGAGGTTCGTGAGCCAAGATC
CAAGCGGACGCATGGACGGGAAGGCCAACTTCTCCCACGACTTGGGCACTCGGTCCAGGAACAAACTCTCCTGCACAGCCTCCATGGCGTCCGACATGGT
CAACTCGCCTGCGAACCCCAGGGACAATTCGTTCAGCGACCGCACCACTTCAGCCAACAATCCGTTCATGGCCTCGCACTCCTGGATAAACACGTTCTGG
TACGGCCCCATCTCCTCCAAGCTACGTGCAATCTCATCGCACTCGAATTTCTTCTCGCCCACACGAGACAAAACCATCTCCAAGCCTTGCTTAGCCAGTT
CCAACGGACTCATGGTCGCGTCTCCCGCTGCAGCGTCTCGAGGCTGCAGCTCCATCAGAGTCCGGAAGAGATTCTCTGACTGAGTCGTACGGAAGTCGAT
CTCAGCGTTCGGGTGCAGGCCAAAAGCCAGAGGTGAATCCGTCTTGAGCTCCGTCTCGATGTGCTCCAAGTACTTGTCGTACGAGGACGGAGCGAGACAC
ATGAAGGACGGACCCTTCTCGTCTCCCACAAACGGGAACATCTCCATCTCGTCCAGCAGCTCGTCGCGCATGTAGAAGTCCAGGTACGTGTTGGCCAGCA
GCCGATCGAAGTCGTTCACAATGTGGCCACCGTACATGATCTCCCCGAAGATGTAGCGCAGATCCGCCCACGGGATCTTGCCGCCAGCTGAGCTTTCCAG
ATAATTCTGCAGACAAATGGCCGAGTCGCGCAAGTCGCCGAGCGAGAAGGGGTACATCATGTTGAACCCTAGAGGCCCGTACATCTTGCGCTCCATGAGG
ACAGCGTGGAAGTGGCACAGGCCGAAGAGAATGGACTTGACTTTCCCTTCTGCTTCTTCGATGTATTCCTTGGGGAAGCTCACAAACGCCCGCTTCAAGT
TCGCCTTGAGCCCTGACGGAGGCTCGTTCGTCAGCTTAATGCAGCGGTTGAGAACTCCGATGGGGATCGAGTTGGACGGATCCGACGTCAGGAACAAGCG
GAAGTTCTTGTGCGAACCCTCGAGTGCGAATTCATCCAGTTTCTTCTCCAGCGCTAGCAGCCAACGAGGCATCAAGTGGATGTTGTTGAGGATGACCCAG
TGACCATTACGGTGCGCCACCTCCAGACGATCCATAGCGAATACGTCCTGCCCTTGGCCCATAGACACGTTATGGTAGCTTACGCCTCGTTCGAAGCCGT
ACTTGACGCTGAGTTTGTCCACGCCCGCCACCACGTCCGCACCAGGAGACAGGATGAAGTACAACGGAGTCGTAGGCGTGGAGTCCAGGTACGAGTTGTC
CATGACCTGCAAAGCATTCAGAGCTGAGTCGCAGTCGCAGTAGTTGCTGCCGTTGGGCAGAACCTGGCGCACGAACTCGTTCACAGCCACCGTCATGCGG
TCCGGACGCAGACAACGCACCACCAGAAGCTTCAGGAACGGAGTCCGGTCCAGCCCAGCCCAGTCTAGCGGCAGCTTCTCCGACTCTGGGGTCACGTGGT
TGTACCATTCTCGGAAGCGTGAAGACGCCTCCTTTAAGTCCTGTGGCATCTTCTGGAACTCCTCAAGCTGCGCCAACATGTTGATGGCGCTCCATTGCGC
AGGAGGCAGCCAATCGATGGGGTTCGCTTCCTCTTCTCCTCCACCTGCTGCCGCCTTCTTGGGTCCTCGCAACAGGAACTGCATATAGGCTTCTTGCACT
CGAACGTCTTCACCCAAAATCCCTCGACGCATGAGGTTAAATGTGAGCTGAGAGAGGAAAATGAGCTTGTGCGCTTCGAACAACCCGCGGGAGACCCACG
TGTAGATAGTGATCCGCAGAGATTCGCGTAGATTCAGCACTCGCTCGCTCTGCTTGTCGCTCTGCGGGGCTCGGTCGATGGAGTTGTAGAAGAACGTGAT
GAACGAGTCCAGACTGTAGCGGTACATGTGGTCGATAGCGCTCAATGTCGTAAGTAAAAAGTAGAGCATGGCTCCTTCTGCCGCCACTGGACGGTAGAGC
TCTCGCGTGTTGTTGATGACAATCTCCGTCTCCTGGTTCTTCTTGACTGAGATGGAGATGTCCGTCGCCTTCTTCTTGGTCTCCTCCAGACTCTCGATCA
ACGGTACGTCGCTGAGGATATCGTCGGGCGCGTTGGCCAGCCGCTCGAGAAGTTGGTCCTCCAGCTCCACCAGGTCGATCTTGAACTTCTGGAAGGCCAG
AACCAGCTCCTGCTTGCGCGCTTCGAGCTCTGGCTGCTCCTTTTTAACCACTTTCTCCAGCAGCTGGTCCTCCAAGCCACTTTCAGTTGCGATGAAGTTA
ATCAACGTACATTGAGCAGCAATCTCCGGCTTGTAGTGAGGGTTGGACAGCTTGGTCTGTAGGTACATGAAGAAATTCGGGTCGTACTGCACTTCTTCGC
CTGCCAACTTCAAGAAGAGATTAGAGCCTTTCTTGTAGACTGCACGACCCAGAACGGGGTCCAGTGTGGCGTCGATCTCCTCTCCGATGTTCTCGATGAT
AAGTACGTGACCATTCACGATCGCCGTCTCCGTCTTACGTAGCCACTGGTTCTGACTCAGCTGGAGCACTACCAGCCCTCGGTCCTTCTCCTTCTCACGA
AGCCACTTGATCCCTTGCAACTGCGGATCGATCACCAGCGGCCAGCGTTTACAGCTCGTGATGATAGCTCCATTCTCGATAGAGATCCGATCTGCTGGCA
AACCTTCACTCATCATCTTGGCGTTTTTGCCTTCAGTGGTCAGCATGGACAAGGGATCGATACCGTCCGTGATGGGGATTCCCTTAGCCACGAGGTCTGG
GAACCACGTTTGCTGCCACAATTCCTTACGCACAGCCTGGTCGAAAGCACCAATGTACGAGACGAAAGCTGCAGCCAAGAGGGAGTTCCCCACCACCATA
ACTCCAGAGTTTTTTAGTTGCTCGATCTCAATACCCCAACGCTCGTTCTCACTGGCCAAGCCATTGACCAGCTTGCCAGCTAGCAGCAGTCGATTCTCAC
AAGACTCCTTCATCTCCTCCACCTTGAGTTTTTCCTCGGTGGCTTGGCGTAGAGTGTTCTCTAAAGCTTCCAGTCGCTTCTGAACCTCAGCCACTTGGCC
CATAGCTCTTGCCAGCTGCTCTTCGGCCTCTTCTTTCTTCTTCTTGGAAGCCTCGAGCGAGTCCATGAGAGGCTTCACACGCACGTAAATGCGGTTGAAA
GTATAGATATTCACGACCCACGAGCAGATATTAGCAGCTGCAGAACTCTTGGACGCCATTTTTTCCGCTGTGAACTCGGGATCGGCAAGTAAAGGCTCAA
TACGAGCGATATCTGCCTCAGGGATGTCTTCGCCACGGAATTCCTTCAACGCGTCCAGAAACGCGCCCGCATTGTTCATCATTTTCTTGGCGCGGTCCCA
TTTGTGGTTCTTGTACTCTTTCTCCACCAAGATCAGACACGCCTTTGTCACGTTATCCACTCCTGCAGGCGGCTTTGGTAGACTCTTGAGCTCCGTAATG
GCAGCTTTCGACAGACAATCCACAGCAGCAGCCGCAGCATCCATAGCTGGCTTAGCTTGACTCAATTCCTTCTCTGCTTCCGCTGCCAGTTCGGCTGCAG
CGGCACTAGCGGCTTCGGCTTTGAGCTTCTCCTTGGTGGCGTTCTCCTGCTGCACCTCCGCTCCTGCCTTCTCCCGTCCCATTTGCTCCAGTAGTTGGTC
AGTAGAAGCCTGCTTCTCGGCCACTTTGACCATCGTGTGCTTGAGATCCACCTGCAGTTCGGCCACATCGGCCGACGTCTTGCGTAAAGTGGACAGTCCG
TCGTCCAAGCGAGAGATCTGGCGTTGAATGTCCTCTTTCCGCTGCTTGAGCAGGATCTCGTAGAAGCTGATGAGTTCCAGGAAGCTCTTGGGCGTCACGT
AGTTGTATCTGCGCTGCGTCTCGAAGTACGTTTTACTCATTTCAGTAACGGAAATGTGCACGTCGGCCATGTGATTCGCCAAATTGCGTTGCAAAGGAGC
GTCTCCGATGTCTTCGAACTTCTCCAGGAAACTGGAGGCTACACGCACTAGAGCGTCACGCGGCCATGGGTGAAACCAGTCAATGACGGTGCAGTTCACG
AGTCCAGGGAATCGACGAGCTCTCACTCTAAACACAGCGCCAACAGGAGAGAAGCACATAACCACTCGGAAGTTGAGACGGATACGAAGTAACAGGAAGT
CCATGAGTGCGTCCATCGCGTCCGGGATGCCGTTAGCCTTCGCTTCACCTCGTAAAGCACCGAGAAGGCCGTCCAGGTCTTCTTTCGGGAATAGATCAGG
GATCCAACCGGACGAAAGCATGTCGTTAATGTACACTAGGAACCTCTCGTTCACGATCTGCGAGTCTGTGATAAGGAAGACCAGTGGAAGACCCTGGACG
CCTGCGATCTTGAACATCTCTGCCAGACTCTCTTTGAGATCTTCAATACGGAAGTTGGAAGTGACGGACAGTTGACGCACGTCGAAGCCGCAGATATGAG
ACGCCAGACGGGAAAGAGACTGCTTGCCGCTTCCTCCGACGCCGATGAGCATCGCATTACCTCCAGGGTTGCCAATGATACGACAAATGCGCGTCACGTG
CTCCATGGCATTGTCGAACAGCTCCAAGTTCATCATTGAGTACTTGGAGTTGTAGTCGTCCAGCTGCTCCACCAGCACCTTGTTAAGCGCCTTCATGGAC
GCAACAGGCATGTAAACGCTGTCCGCTCCAGCCACCGGCGTTGCGAAGGTCGTGAAGATGTTCACAGGCACTGGTGCGGTCTCTTCTGAGCCTGGAGGAG
GCGAAGGCTGGTCGTTGAAAAGCACCACCTGGTCCAAGTCAGGCAGCGTCTTCTTGGTCACCTCTCGGATCCGATCGCCGAACTTGAGGATGTCCTCGTC
ATTGATGAGGCGATCGCAGAAGACTCGAGTGGCTTCATGGACCCAGAGACGAGCGAAGGAGAGGCCGGTGGGGAAGAACTCGCCTTTGGACCGTGTGAGG
CCCTGGAAGATGTTTGAGAGCTCTCGCATGTTCCAGTTGTAGACGAACTTGGTGGCGCTCGGGAGGAAGCGGTTTACCATTTCTTCATGCAGGAGGATCG
AGACGTTCACAATATTTTCACACACTGTGATCACGGGGGAAGCAAAGCCTGCGTTCTGCATGTGGCCCTTGAGGATAGAGTTGAAGATAACCTTAAGGTC
TTCCCGTCCTGGCATCATACAGGCAAAAAGTGCATAATGTCGCTGTAAACGCTCGTCGATGATGAAAGAACCGGCCGTGGGATTCATAGCTGACAGGTAC
TGAACATCCACGATCTCCTTCCGGAAGCCTAAGTCCACACGATCGAAGAACGTCTTGTAGTCCATGTGCTGTCGTAGCAAAGCCAGCGAGTTCTGCGTGC
CGTACGTCTCGATATAGGGCAGATTCAAGTCGTCAATGAAGTAGATGAGTCTCTTGGTGGCTGGAGGGCCGAACATTCGCCCAGAGCGTTTATCAATCAC
AGATTCGAGCTGCTGTTGAAGTTTGGCCGAATCTGTGTAGTAGTTCATGTTGATGTTGGAGAACAACATGTCGTCGTCCAGATCTCGTAAAAAGTTCTTC
AGAATCGTCGTTTTCCCCGTTCCGCTACCGCCTACAAGCATCGCTGGACGCTGTCGAGCAACCAGTGTCTCCACTAGGAAGCGGATGCGGACGGAGTCGT
TCGTACTGATCACGATCGAGTTGAACGGGGTGTCGGCTGGGCCATTTCCGATGGAACCGGGAATGTACTTTGGTACTTTGGTGCTCCAGCTCTCGAACTC
GCCCGACTCTAAGTTGTAGAAGTAGTCGAAGCATTGTCCCTCCTTCGGGTACTTGACGTTGGTGAACGTAGAGCACCAGAGCTCGTGGAAGTTCTTCCTG
TAGTCGATGCTCTTGTCCACAATCAGCGGGCCACCGAATGCCCACGTGGCGCAGAAGACGAAGATGGACTCGATGACCTCCGGATTCTTCTTCTCCACTG
GGATGTTACCTAATAGTCCTTCCAGTAAGTAGCAGATCGTCGATACCTGGTTGATTAAACGAACAGGAGCCACTTGTTTGTATCCTTTTCGCATGAGATC
GTAGATGGGGTCCACATACTTGTCGAAGAGACCAGGCAGATACGTTCTCTCCACTTCCTCTTCACGTTTAGCCACCCAAGACTCCATGAATGGCCTCCAA
CCGATATCAATCTCATTAATAAACAGGATACCAGCTCGGGAGACGGTCGCAGGGGTAGCGTTCTTAAGCGAATTGATCTCAAAGACCATCCGCATCGCAC
TACTGAGTGGAATCCGCTCGTTCGAGACCAAAGTCAGCACCTTGTTGTCGTCCATTACCGTGTTCATGGACTCGATCCACACTGCATCGATATCTCCATC
CAGCACCACCCACTTGTACGTCTGGCTCTCGTAAAACCCTTGCTCCGAGTAGTTTTTCGCCATCCCACGCATGATAATCGATAATACACCGTCTTTCCAG
TCCTTCGACAGCGTCATGTATCCATATAGTTCATCGGAAGTCACGGCCTTGGGGTTGAGCGTCTCGTACACGCAGATCTTCTTCTCCTTGCCCAAATTCC
AGCACTTGGCCAGCGCCTGCCACGTCGTGGTCTTAGCGCATCCTGCAGGCCCTAGAAGCATGACGGAGTGGCGCACATCGATAAGCTCCTGCAACTGGCA
GATCTTGAGGATGAACGAGTCGTCGTGCTGCAAGTTGTTGGCCTTACACACCGTCACAGCCTTCTCTCTCAGTTCGACATTCACTTTAGGAGCCACTTCC
ACGCCGATGAATAGATCGTTGATAAGACGCAGGAAGATTGGCGTGTCGTGGTGCGGGATCTTTGGAGTGTTGAAGTCTCGTAGAGCTCGCATGAGAACTT
TATCCTCTTCAACGTCAGGCTCCGCTCGCTTCAAGATTCCAGCCACTCGAAGCACGGACTTGACAGCGCGAAGGCCCCAGTCATAGTGGAACTGCTTGGA
CAACAGCTCACCACTTAGCTCGTACAGCGTCACGAACTTAATCGCCAACGTCCGAGCCTGTTGGAAGCCTTCGGACATGAGCATATTCTCGCAAATAGGC
TTCAAGTCGGGTCGGATCATAGCACACGACCGGAAGAGCACCTTGAGGTTCTCTGGAAGCTCCGTACGTCCAGCGTAACCAGGGTTCATCGTGATGAAGA
AGCCACACGTCGGGATGAGTGTAATACGATCCGAAGCGCCCATGAACTCGAACTCTCCCACTACAACGGGGGGAGTTCCTGCCGGTAGAGACTGGTACTT
GGCTTCTCGGTTCGTAGGAACAGCGTTGAACACGATAGCGTCCTGAATGCATTTAACTTGAGTAGCCACCACACTTAAAACCTCGATGTTGATGCGGTTG
AACTCGTCGAAGCAGCCCCAAGTGCCAGTCTGGCAGAGGCCTCGGAAGATATCGGCCATGGTCTGGTAGTTCATCTGGTCCGAGCAGTTGAACACATAAC
AACACAGTGCCATAGCTCGAGCCAAATCCTTCGTGGTTTCTGTCTTCCCCGTACCTGCAGGACCAGCAGGAGCTCCTCCTAAGAACAACCTCAACGCCAT
CGTTAAGGTGATGTAGCAGCGATCTGTAAGAGGAGTGATGACGAGTCGACCAGTGTTGCCGATCCATTCGTACGAGTACTTGGACCGGAAGTCGGTGATG
CGGATATCTACGTCGTAGTTCTCTTGTCTCCAGATGAAGCGCAGTTGCTGCTGCCACATGAAACTTAGTGGGCCTTCCACCTTCTCGTCCACCAGTTTCT
TTACTACATCCCTCGAGTGAACGTCCAGAGTGATGAGAGCAATGATCTTACATCGATCAGGACTGGACAAGTTCCCAAGCACGAGGTTAATCAGCTGTTC
CAGTCTTTGGTTGCACACTGTCAAGTATCTCTTCACAGAGTCTTCCTGCCCATTCTCGAACTCTTCCAGAGCCATCTCCGTCTCCTCCGTCCAGTAAATC
TGAGTGGAATTAAGCACCACTTGAGCTGGGTAGTCAAAGAGCCACTGGTGACGAGGCTTCTCCACATCCCAGTTAGCTGCAGTCTCGATCGAGTCGTGCA
TCTCCTTCCGCAGACAGAACCTCATGGCCTCTGTCAATTCATTCAGCCAGCTCTCCACTGCTCCAGCCATGACGAAGATCGTCGGAAGTACGACTGATTC
TCCGTCTTTAGCCACCATAGTGTGTGCTGTATTAGGTGAATCGTCCTCGAAAATTAAGTCGCACAGGGAATCGTAGCAGTCTCCAAGGAACGGCATGATC
TTCTTGGGGTTGTTGCCGTTTGAAAGGATCTCCAGCAGCGCCACGTTCGACACGAAGTAGAACCGAGGGAAGATCTTCTTCTTCTTGTCCAGATATTCGT
TCAGAGACTTCTGACACTTCTCCAACATGGCTGTCATCTCCTTCAGGCTTTCGAGTCGACTGTCCACTGTGCAAGCCAACACCACATTTGGCTCCATCAC
TGCGTTCTTCA