Description :
From Genome Similarity Track
Location :
Scaffold_2408:1388- 3208
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2408-snap-gene-0.1Sodium/glucose cotransporter

Sequence
1820 bases(100 bases per row)
AAAGACCTCTAGCAAGCCCCAAACAGGAAGAGTCGAACTAATACCATCGCTATTCGCTGCGGCTTCATGCAATGTCACTCAAGTGTCGGCGGGTCCGCTC
CGCCCATGCTCCCTCTGTCTGAATGGTGGGTGTTTTTTCTGTGAAGCCTTGACCCGTGTATTACTGTATGAGTCTTCTCCTTCTTCAACGAGTCCTGACA
CTGGTGGTGGAGATGGTCCGTCATCTCCTGGTGTCGATATTTGGATGTTCTCGAACTCGGGCGCAGCCCAGAGACAGGCCGCTGCAAAGGATGAAGGCCA
TCGGGACGGTATCAATTATCATCTTTCGCAGACTCCTCCCTCCCCTCTCATTCCCTCCTTGCAGTTGAACCCCCCCACGAGCAGCTATCATTCCTTCACT
CGTTCAGTTCGCAATTTGCGCCGCGGCCGCCACGTCTTCCGCCTCCCTCCCTGACCAAGTCCCCGACCGCTTCGACTAAAAAGCCCTCGAACCTACTGTC
TCTCTCGTCGGCCATGAGTCATCTCGTGACGCAGATCGCGCCGCACGCGGATTCGTCCGACTTCATCGCGGGCGACATTGTCATCCTCGTGGTCGCAATC
GTCGGTGTCATGTTCATCGGTATCGTCGCGGCGATCCAGGCCGGTGAGACGCGCTTTGCCAAGCTGCTGCCGTGCATCAAGCCCCCCGCGCGCGCTGCCG
ACGACGACTATGTCGAAGTCGAGCCCACGCCCAAGAGCGTCAACGCCGCCGAGAGCCAGAAGACCTACGAAGAGCACGAGCGCCAGAAGGAAGCCGCCGC
GGTCAAGAGCTTCTTCCTCGCCGACCGTGGCATGAAGTGGTACTTTGTCGGCGGCGCGCTGTTTGCCAGTAACATTGGCGCGCAGCACTTTGTCGGCATG
TCGGGCGACGGCGCACGCCGCGGCATTGCCGTCTCGGTCAACGAATGGTACGCCGCGATTCTGCTGCTGCTGCTCGGCTGGCTCTTCTCGCCCGTGTACC
GCCGCGCCGGTGTGTACACGACGCCCGAGTTTCTCGAGTACCGCTTCAACGCGGCGTGCCGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTCTCGGTGCTCACGGTCGTCATGTACGTGCTCACCAAGACAAGCGCGACTATCTACGGTGGTGCCGTCGTGCTGCAGTCGACGCTTGGCTGGAACT
TGTACCTCGGCGGCGGCGCCTGCATCTTGCTCAGCGCGCTCTACTCGATTGCCGGCGGTCTGCGCGCCGTCATGTACACGGACTTTTTCCAAATGTGCGT
GTTCCTCATTGGCGGCATCGTCGTCATGTTTGTGTCGCTCCACAAGGTCGGCGGCTTTCAGGGCATCCACGACAACCTCGAGGCGCAGGGCCGACTCGAC
TTTTGGGAGCTCTGGAAGGGCACGGACGATCCGGACTACCCGTGGACGGGCATGTTGATCGGCCAGCCCATTGGCTCGGTTTGGTACTGGTGCATGGACC
AAGATCTCGTGCAGCGCGTGCTCTCGGCCAAGGACACGTCGCACGCCAAGGCCGGCACGGTCTTTGCCGGCTTCCTCAAGATGCTGCCGCCGTTCCTGAT
TGTGATCCCCGGTGTGATTGCGAGTATCTTTTACGACATGAAGGTGCCCAAGCGTGGCACGGACGCCGCGTACCCCGTGCTGCTCACCAACTTGATGCCG
CACGGTGTGATCGGCTTGATGGTCGCGAGTATCGTGATGGCCATGATGTCGTCGCTTGGCTCGGTGTTTGCCGCCGGCTCATCGGTCGTGACCAACGACA
TTTACCTCAAGTTCCGTCCG