Description :
From Genome Similarity Track
Location :
Scaffold_1574:1388- 2844
Transcript NameFunction/comments
Phyag_g11000hypothetical protein PHYSODRAFT_255937

Sequence
1456 bases(100 bases per row)
CGTAGTAGGTCGTGTTGGTGTACACGACCTCTGCGTACTCATCAGGGCAGTATGGGAATGTCTTGTCGCTAACGATGTCGAGGAACAGGTCGTGGCCGGT
CGTGTACGTGACGTATCCACCCAGACCAGtgcagacgatgatgatgaacgTGCCCATGGCCTTCTCGTACCAAGGAATGCGGTTCCAGAACACCTTGAGG
TAGAAGAAGATCGGCAGGATCATACACGCGAGAGACACCGCCCACGCGCCGACGAAATCCGAGAAGTCCATGAAGTGGTCCTTGAAAATGATGGCGAGGA
TGAGCAGAATCACCACAACGCAGATGCGCAGTGTCACGTACTTCGCGATCACTACGGGTCCGCTATTGTGGTATTCGTTCAGAAGAGCTTCCGGGGTCAG
GTCATGCTCGGCATCGGCCATCGAGGTGACGGAAGGGCGGCCGGTAGTCATGTTCGGCGCGCCTTCTTTCTCACCAATACGGCCTTGCGGGGTGTTTATA
ACGTTGAATGCAGGAGATTCCTCGTCCACGGGGGGAAGGAGAGGACGCTTGTGCATGCCCAGAACACCACGCTCTAGAATGTAAAGCACGGGGTTCAGGA
TCACGGACATAGCAATGGTGATGTGCAGCTGCATGAACATGTAGGCCAGCACAACAGCACCGCGGTTCGCGTTCAGGTTCAGGGCTGTGCCGTTAATGGC
GAACAGGAGGTTTCCGGGGATCTGGCAGCCCACGTAGGCATACGACGTCTCGCCGATGAtgaggaagcagcaggcagCGAAGATCATAGTGCACGCAACA
ACGCGAGGCATGCGCTCGGGTTGCGAGTGCTCACGCTGCAGAGCAGGCACCAGAACGGCAGCGGAGTAGGCCAGAGCCAGGTTACCAAAGGAGCTTGCAG
CCTCGCTAAACTTGATGTCGGGGGTGGGCACGGACGGGTGGTCGTTGCCAATGCCCACAGCAAGAACAGAGATGGCGATAGCATCAGCCAGAACGGTGCC
CATGCAACCGGCGAAGGCAGCGTACGCGCCTTCCTTGAGCGTTGGTGTCACAATCACAGGCAGCAGCATAGCAGCCATGATGATGCTCCAGTACTGGGTA
CCGAAGGCGTCGGGAGAGATACCATCGAGCAGGATGCCGCCCAGCACGAGGTAAGCGCAGGGAACAAGGAGGCACACGCCGAACtgcgcaagcagcacga
ggtAGCGTCCGATCTTGCCGCAGCACCACTCGCCGATGTCGCCGTACGTCTTGAGGGTCTTGGGGGCTGCGAGACACACTCGGGAGATGGCTACGCACGA
GCAAACGTTGGCGAAACCCATAaagagcagcgccaccgtcgcgATGGGGGCACCCGACCGAGCGAAGTTGGCCGGCAGACCCAGCGTTCCGATGCCATAC
ACGGTacagaagaagctgaaggagatctTGAAGTCTTCGAGTGTGAAGAACGGCAT