Description :
From Genome Similarity Track
Location :
Scaffold_74:138780- 146324
Transcript NameFunction/comments
Phyci_10613NADPH-dependent diflavin oxidoreductase, putative
Phyci_232862Hypothetical protein
Phyci_94752Hypothetical protein
Phyci_232960HECT ubiquitin ligase, putative
Phyci_232914hypothetical protein

Sequence
7544 bases(100 bases per row)
GTGCCGTGACCCAATCAGAGACCGACGAGCATGGCGACACCTTCGTCGACGCCGCCGCGGCTGCTGGTGCTGTACGGCAGCGAGACGGGCACAGCGCAGG
ACGTGGCCGAGTTCGTGCAGCAGCGCGCGTTCAACCGGCAGCTGCTGGACACGCAGGTGGCGGCCATGGACGCGTTCCCGGTGGCGCAGGTGCTGCCGCG
GTGCTCGACCGTGGTCTTCGTCGTGTCCACGACGGGCGACGGCGAGGCGCCCGAGAACATGCGCAACGCGTGGCGCGGCCTGCTGCGCAAGACGCTGGGG
TCGCAGTGGCTGGTGGGCGTGCGCGTGGCCGTGTTCGGGCTGGGCGACTCCAGCTACGCCAAGTACAACGCCGTGGCGCGCCGCCTGCAGGCGCGGCTGC
TCCAGCTGGGCGCCTCGGAGCTCATCGACCGAGGCCTGGGCGACGACCAGCACGCCTATGGGTACTTCGGTGCGCTCAACCCGTGGCTGGAGAAGCTCTG
GGCGGCCGTGCTGCAGCTGCACCCGCTGCCGGAAGGTGTAACCATCGACGACTCAGCGAAACCGGTCGAGCCTCGCTACTCCGTAGTCGTGCACGGGGCG
GGGGATAAGGAGGTGGGAAAGGCGGGGAAGCTGACGCCGAGGTCGGACGAGTCCAACTTCTACGCGCCGCCACGCACGGCCGTGATGGTCGAGAAGGGCA
TCTACTTGGCTCCCGTGGTCGTGAACAAGAGAATTACGGCCGAGGACTGGGAGCAAGACGTCAGGCACTTGGAGTTTGATATCAGTGGCGCTTCCTCGAG
TGTGGGTGGTGTGGGTGACGCCCCGTTCAGGGCGGGAGATATTGCCGTCGTGTACCCTGAGAACGTGGCGGGCGTGGACGACATGCTTAAGTACGTGAAG
ATGGACGGAGACACGGTCATCTCGATCTACGCTGCTGACGGGTCGAAGCAGTTCGACCTCCCGTCTCCGGTTACTGTTCGTGATGTTTTCGCAAAGTACC
TGGCCATCCTGGAAATCCCGCGTCGAAGCTTCTTTGAGAGACTCTCGCTGTTTGCAGCGAACGAGGAAGAGGTAAGCTTTACCTGCGACGGGCTTGGTTG
TGGCGGTAGTGCTGACCGTATATATGCGTTGCAACGATATAGAAAGAGAAACTCGAGGAGTTGGCTTCCGCCGAGGGTGTCGATCTGCTCTACGACTACT
GCATTCGTGAAAAGAAGACGTACGCCGAGGTGCTCACCGACTTCCCGAGCGTGTCGGTGCCTTTGACGATTTTGCTGCAACTCATCCCTCGACAGCAGCC
TCGCTCATACTCCATCTCTTCGTCGGCTCTGCTTCATCCTGGACGGGTAGGTTACTACAGATTTATCGTTTTCGGTAGATGATGCTTACCTTTATGATTG
TGTTTTGCTGTGGTAGGTGCATCTGACTGTGGCCATCGTGGACTTCTTAACGCCGTACAAGCGCCGCCGCAACGGCATTTGCTCATCGTTCTTCACATCG
CTCGATCCCTCGAAGGAGCAAACGCGAGTGCCAATGTGGATTAAAAAGGGCCTCTTTGAGCCGCCTAGCCTACAACGCGATGTGCTGCTCATTGGTCCAG
GAACCGGGCTTGCCAGCATGCGAGCCATGGTGCAAGAGCGACAATTCCTTCGCAAGCAGGGTGATGGCAACACTTCTGGTGTGACTTACCTCTACTTTGG
ATGTCGTCACGAAAACAAGGTACGCTTTCGTTTTCTGGCGTGTAGATCATCTCGGAACGTATTTAAGACCCCGCTTGTTATGGTTGCACAGGACTTTCTG
TACGGTGAAGAACTTCGAGGGCTTCTACCTTCAGGCGATCTCACCGAACTGCACACCGCGTTCTCGCGTGACCAGGTGCGCATCTTGCCGTATGTTCCAG
CTTCAGCAATCTGTAGGCTCACATTTGTCTTTCGAACGTGTGTCATGCTTGCAGGACCACAAAATCTACGTGCAGACGCGTCTGGCTGAGAACAAGGATA
CCATCTTCGACTTCATTATGAATGGCGAGGGCTGCATCTACATCGCCGGATCGGCGAAGCGCATGCCCAACGACGTCTACGAAGTGCTCCGTGACATCCT
TCGGTCCGTAGGAAAAATCCCGCTACCGACCGCAGAGAAGGTGATGAAGACGTTGGCCCGCAAGAAACGCTACGTTGTCGAATCCTGGTCGTAGGAATCT
TCACGAACAGCTTGTACAGAGCGAAATACAGTGACTCGTCAATAGACCAACCACTCGAATGCCCATTTGATTCGCTAAAACCAGTGCAAATCGCGGGGCT
ATGGACGTCATGCAGGCGCCGGAGCAGGCGCAGCATGTGCGGACGTTCGTGAAGCTCGCGAACCTGACGCAGACGTCGCAGCTGCACGAGTGGAACCTCG
AGTCTCTCCAGCGAACGCTGGAATGGGCCCGTGCAGCCGAAGATGCCGTGAGTGGCGGTGATACGCAGCAGGAGATTGACATGCGCATCCGTCAGTGGTT
CCCAGTCGCGACACTGCCCACGCTGCCAATTGATGGAGCTCTGACGGCCGACGCTCTACGCCATGCAAGAATTCACTTACTGCGGTCAATTCTGCAGAGT
CCGTTCTTGGCGTTGCATCCGACGCGGTCCGAGCTGCTGGTTGCTGTCCTCCAAGAGCTTCGAAGTAGACGCGAAGACGCTTCCTACTCATCGGTTGACG
AAGCGGAAGAGCACGCGCCCAATAGGTGATGGAGCGGTGGGCGTGGTTGATATGCATATATGCGACTAATCTTGTTGGTGGTGATCCTTCGTAGTGCCCT
GATGGTCGATCGGGTCACCGGGACCCCACGCACGGAAGCTATGCTGGCGATTGCTCGACGCATGAGCGAAGGTTACAATCACATTCGCGTTCAAGGTATA
CATGCTGCTGTTCTCATCCGATTGTGATTGTGGCTGACTGGTTGTTCGTGAAATGGTATCATAGTGCTTTTGGGCTGGGTCTCGATTCCCCCATTCAAGA
GTTTCGCGCTTTCACCACGGACACTGCAGCTGAAGGCCATGGCCAAAACGTTGCAGCGCAATGCAGTCGATGCCCGTGCTGCTGTCAACCCTGAAACGTA
CCGTGGATTTCTCAGTGATCTGCGAAGTTGCTTTGAAGAACCTGAAAGTAAAGACGTTCGGGTAGGCAGCTTTGGCGCAAGTTAATCTGCACTACCATGC
TGCTACTTACGATTGCGTGCTGTGTAGGAAGTTGTGGTTTTGATGGTTGTAATGTGCGAGTGGCCCAAGGAGGAACCTCCACAGCTACGAGGAATGGTGG
AGGACCTTGTCAAGGTTGTACGCGATTGGGTTACGAGCAAACCCATTCGTTTCTGGACCTTCCAACCGTGGTTGGCAGCGATGCTGGCCGGCAAATCGAA
TGCTCTGGCGAGTGCGTATGTATCTGAGCTGTTCAAGACCGGACTTCTGCAACCTTGTACGTCTGTAACCTTATTCAGTTTTTGCTAGCAGATGATCACA
GTTGCATTTTTCAATGCATGAAATTGTTGCAGGGGAGGGAGAATTTGCAGCCCGAGTCGCGACGCTATCCTTACAGGGTGCAGTCGTTGAAGTCGTGTTG
AAACCAGCGCTGAGGGAGCTGGATCCGCATTTACTGGAAACCTACTTTAAAGTAGAATGACCCTGTGGTTTTGACACGGGTTGCTAGTACACATGTTGCA
CACTACGTAGTACAGTTGGTCGGTTAAAGATTATTGCTTTAGCTGACGAAGAACCTTGACGACCTCGTGGTGGTTGTTACGCAGCGCAAGATCTGTTGCA
GTGGCGTAAGGAGCCTCCGGTAGTGGCAGAGTCATGTCGGCGCCACCGTCACTAACTAGTGCGGCGCAGCAATCTGCGAAGCCCTCTTCCCCTCCGATCA
ACAAAGCAGTGTATCCGAAACGATTGCGTTGATTCACCAGAGACCGAGTCCACTCCTCGTCAAGGTAAGCGGACTGGTGGAGGTGTTTCAATATGTTCTT
CAGCGAGGTTAACGCGTTTGACGCTGTTGCAAGATGCAGGATTGAATTCCCATCGGCATCCGTAACGAGTACTCCAGCCCCATGTCTGAAGACAACCCAG
TTAGGTCTACATGTACATCTAGCCGGTACATCGTGGCAGGGTGTGCACCAAAACGTCTTACTGAAGAAAGAAGTTAACAGCATCATGTGCGTCCCATGCA
GATGCGAGTTGCAGAGCTGTGCGGCCGGTGTGAGGATGGCGTTCGTCCAGCAGTGTCGGAATTTCAGCGAACAGTGCGCTCAAAGCAGCGTCGTCGTTGT
CCACTGCTGCGTGCATCCACGAGTCTAACTGCTCCATCACAACTGTGCTTCTCGAGCAGTCGCGTAAATGGTCAAGTAAATTAAGGTTAAGTGTTTTTGT
ATCACACACGGTCTGACATACTTTGAAGTAGCAGCCAACATCGCCATTATCCTGGATCAGTCCGTCGTAAATCCATATACCTCCGTCTCCAGCACCGCGT
ACAACACCGCTTTCAGCTCTTCGCGCACAACATGCAGTGGGAGGTCAAGCCGGTTGAAGCACGCGTGGCTGTGAACAAATCCATCGCCCACCAGTGACAC
TGCTTTCAATGTAAACGGGCACAAGCGACCATCGTAGCTCGTCAATGCCCTAAAGCCACCCAGCGGCACACGTGAAGAGCCCGTCGAGAACTGCAGCAAG
CGGCGGCGGTATTCATTTGGCATCTCGCGCACAAGCTCCCAGAACCATTTGAGTGCTCTGTGGTGGTGTAAGTCTTCCGAGTACTTGGCATGGCGCTCCC
AGTCGTCGACGTCAATCTCATCGGAGCCGCAGAGTAGAAAGTTGAGTTCCTCAGGGTCGAACAAGAGTAGCAGATCCTTTGGAATAATTTCGTACAAGCC
GTGAAGAAAGACCTGCAGCTGCGGCGCCACACTTTCCACCATCAAGTATTGCCACTTGCGCTCCACGTAATCGCGCTTGTTGCTATCTGTGACAGGGATA
GTGTTACCGCCGGGTACAAGCTCGACATCACGGTAACGACCTCCATCCTTTACAGTCACGACAAAATCAAGTCCTAGCGCATCCACGTTGTCGTTTTCGA
GCAGCCATCGCATGTTCGTATACACTTCGGGATCGATGTCTTCCAAGTCTGAAAAGCTAAGCGGGTAGCCTAACATCAGCTTCAGCAAAGGAGGCGCCAG
GTGAAAGCACATCATTGAACCTTCTAATAGTGCGCGACCAAGAAGCCGACCGGTCGCATACAAGTGCAGTAGCTGGTCTGGCAGGAGATCCGCATTTGAA
CACGGGCTCAAAAAATACGTTTGCTCGCTCTTGTTGGTGCAGACGAACAGCCCATGGGCAGGATCCACGAGCATTTCATTCAGAAGGACGAACCACTCAC
GATGCAGCCCTCCAGCATCAACTCCGCTCTCGTCTAGGAAATTGATGCGTAGTACAGAATGCACGTTTTTGAGTGGAATAATTGCCAGCGACTCCATTGA
GTCTGCGAAAACGTTCGCCCGCTCCACATTCAGCCGTAAATGCTCCCTTTCCGCAGGAACTAGTAGTGCCGACGTTGCCGTCACGAAGTGGGCGTACTTT
GACGGGAAATCTTTAGAGGCAAGTGCCATCGTCTCATACATAGGCGTTGATGCCGGCGGTGTTGGTGTCTCCCCTCGGGTGTTACTTTGTTCGGCATTCA
CCCCGAACTCACGCTCGAGGGGGAGCTTCGAGGCAACCAGTGCTGGGTCCGACGCAACTGTGAGGACCGCGTGCTGCGTCTGGGCGTCTCGTACCAGGCC
GGCGATACACTCTTCAACCGATCCCAGCAATGAATGTTGACGGCTTGTTTGGTCTCTACCATCTGCATTTTCCGCAGTAGTGCGCTCTTGTTCTGGCTCT
GGTTCTGTGGTGTCCGTACTGGTAGAGGCCTCCACGCCACCACGCTGCGATACAGACGCCGAAGACGGTAACGAAGATCTCGGCGACGCCACCTCTCCTG
AGGCAACTGTGGAGTGTCCTTCCGACATAGACTTCTCGTCCTCCAGCGACGGTGTCGTCGGTCGCCGATCCATCGCCAAATCCAGAGGCCCACCGTCTAC
AACCAAGAACCTGACCACAAAGCCTGCAAACTGTGTATCCCCCCACCGGCCATCCCGAAACCAATATGCACGTCCTTCGACGTCCACTTTCCTTGTCCAC
TCCTTCCTCCGTTGAGCTCGTGCAAGGCGACGACTTGTCTGCACCGAGTGCGTCGCCGTGACCAGCTCCACCCTACTCTCGCGCTTGAACAGCGGCAACA
GCGACAGCCGCGTCGACCGCTTCTTGTCTGCAGCAGCAGCGTCGCCGTCTCGCTCGACGAGAGCCTCCCCGCACACGGTGCAGAACTTGAAGCGCTTGAA
GTTCTCGAAGCCGCACTCCGAGCACACGTTGAAGCCTTCCTCTGCGTCCCTCAGCGCTGCGTCCAGCCGGCGGTCGTCGAAgctgcgcagtgcagtgcag
tgcattacattgcagCAAAGGCCTCAGCGTTAGTCTTCTGTAATGCAGCAATGTAAGAAAGTCTGCAAAAGCTTCATTTGTGACGCACTCGAGCAGCGGC
GCGTGCAGCTCCAGGGACCGCTGGCGACGCATGTACGCGCGCCTGGCCAGCATGGACAGGAAGAAGAAGAGCAGCGCCACGATCGCGAGCACCACGAGGA
AGCCCAGCACGGCCTCCATGGCGGCTCTGCGGTCGAATCCGAGTGTGGCGGTCGCATGTGGCGCCCGTCGAGCAGCAGCTACCGTCATTCTGATTCGCTA
AACGCATAAGTGTTCACCATACGTACACATTTGATACTACAATTAAGGTAAATGGGACGAGAGGCCTACACTTTTGCGCCACCAAGTGGCGGTACAGCAG
GATGAGTGTAGGGTCTGAACCGGACCGTACACCGAAAGGATGCGGTGCTCCGATTACTCGACGCTCCGTCCGCCGATCATCGACCACAGAGTACTAGGCA
ACAGCAGTGTTGCAAGTTGCGCTGGACAGAGAGAAAAATTCATTTCATTGACTTTGCGCACGACGGACACTTCTAAGCCACGGTCAGTCCGTCGTGAAGC
CGTACACTTCCGTCTCCAGCATGGCGTACAGCACCGCCTTGAGCTCCTCCCGCACCACGTGCAGCGGCAAGTCTAATCGATTGAAGCACGCGTGGCTGTG
GATGAACCCGTCGCCAACCAGGGGCACGGCCTTCAGCGTGAACGGGCACAAGCGACCGTCGTAACTCGTCAACGCGCTGAACCCGCCCAGCGGTACACGC
GATGAACCCGTCGAGAACTGCAGCAAGCGCCGACGATACTCGTCCGGCATCTCGCGCACCAGCTCCCAAAACCATCCGAGCGCTCGGTGGTGGTACAGCA
CTTTGGAATGCTTGGTGTTGCGCTCCCAGTCGTCCACGTCGATCTCTTTGGAGCCGCACAGCAGGAAATCGAACTCCTCCGGGTCGAACAGCAGCAACAA
CTCCCGAGGAATGATCTCGTACAGCCCTTGAAGGAAAACCTGCA