Description :
From Genome Similarity Track
Location :
Scaffold_218:13878- 15247
Transcript NameFunction/comments
Albla_Nc14101670Major Facilitator Superfamily (MFS) putative

Sequence
1369 bases(100 bases per row)
TCTTCGTCCTCCTATGTGCCATCAATCTGATCAATTATCTTGATCGAGGCATCATTTCCGGTGCACCCGACACCTTTGACGCTTTTATCGGAAGGACATT
GCACGTATCAGCAAAAGAACAAAGCGTCTACCTCGGTTTCCTCGCATCTGCCTTCATCGCCAGTTACTCGGTTGTATCCATGATCTTTGGTTACGCTGCC
TCTAAATACCGACCGTTTCGGATGATCGCACTCGGTATGAGTATCTGGGTCCTCGCAGTCTTCATATGTGGTGTGGCACGAATCCTCAACAGCTACTACA
TCCTAATTCTAGGACGACTCCTAAGCGGGGTAGGCGAAGCCTCATTTCAATGTAACGCTACACCATTTCTATACGCCCACGCGTCCCCCAAAACAAGAGC
CGCCTGGCTCGGTTTTTTCCTCATTTTTGTGGTCGTCGGCCAGGCACTTGGATACATCTATGGAGCGCTATTCGCCAACTCGAGACTTACCTGGGCAGGC
GCATACTTTGTCGAAGGTATCATTATGACATTTCTTATCATTTTGTGCTTGGTAGCGGTCCCAGAGCATCTCAATACAATGCAATCGACAAAGTCGTCGG
GTAGGCCTCGATCCGACCATCCAACCAGATTCACACATTGCGATATCACCACACAGCTGATGAATCAGGACAGTACACACTCTATCAAACGTGTCTCCAA
GCTCACGCCAACGCTGTCTCGAATCCCTGAAGCCGAAGAAGCTCTTCCGGATGTCATTCTTCGACCTGATATTTCAGACCCATCGCTTCAATCGTTTTGG
ACGCAAGTTGGCCGGATATTTCGTCATCCCGTTTTCACGCTCATTGTGCTCGGACATGCAGCCAATACGTTCTCTTTAGCTGGATTGAATGTATTTTCTC
CGACGATATTTCTCGGGCTTCGACTGTTTGAGAATGAGACTCAAGTTTCATTCATATTTGGAGCAATTGTGGTCGCCGCTGGGGCCGTTGGAACGTTATT
GGGCGGCTTTTTGGTTCATTTGATCACGCAAGACGACACCAAAAGCAATCACTATCGATGCTATCATTCGGTGATTCTCCTTTTCACTTCGATGGTCGCA
GCGTTTGGATTTGCGTGTTTTATGATGCTCTTTACCACCCAGAGAATCGTATTTCTTTCTCTATTGGCGGTATCATTACTCTTCCTATGCGCTCTTTCTT
TGGCCGAGACAATTGCTGTCATGGAGTGCTTCTCACTGGCACAGAGACCGCTAGCGATATCATGCAATACGCTGGTCATTCACCTGTTGGGCGATGTTCC
TTCTCCGATTGTGTTGGGATGGCTCAAGGACACTTGGGCTCCGCATTGTGGCTCTGTCGAGATCGATGG