Description :
From Genome Similarity Track
Location :
Scaffold_242:13877- 15689
Transcript NameFunction/comments
Phyag_g3868hypothetical protein

Sequence
1812 bases(100 bases per row)
GAACTCAGGCATctgaagctcaagctgcatAGTCTTCCGCTTGATCTGCGAAGCAACAATTTTTTGAAGAGCaacttcctgctgctgttgacgtTCCGGT
GAGGGCTCGTCAGCAGCTGCCTCGCGAATTTCTTCGCGCAGTTGGGAAACCTCTTtttcagcctcctcctcttgcaGATGCCACAAATCTAAGCTGTGGC
GTCGATcacgagatcgagaagcacGAGGCGACTCAGGTGTTGGATCTTCTACATCCTCTGCATCTTCATTTGCTGGAGCGAGAGTTGATAATTGGAAACG
GCGATTCCTGCGCGAGTTTGGTGTCTGAAGCTTGGGCTTTTGTTGGCTATCCGACAGATCCACGACGCAACCGACATCTTGGTCATCAGCAGCATTGGGG
TTTCCACAATTGTTCAAAGACAAAAGGTCGTCTGATaactcgagctccagttGGTTTTCGCAGTCATTTTGGTTGctgttttcttcttctgcaggtGAGT
CTTCCGTTGTGAGCATGACAACCTTCTGCGGCGATTGATGTGCTGGGTCCATCGCCGTAAACGAAGGGAACGATTGTTGCTGGCGCTCTTTACTCACACT
TTGTGCCACCAGGACCTGCATTTGCCGGCGCAATTCAGCCAACTCGTCCTTCAGTTGAGCATTGTCCTCCTTCAACTTAGCCACGTTCCTGCTCTCGTCA
CGTAACGCCTTCAACACCCGTTTAGCAGCACGTGTACGCGCCGCGCATTGAAGCGATAAAGTCGCTGTACACAGCTTTCTGTACTTCCGTTGAGCAGACG
CCCGTCGCCAAGCTGTGGCAATGCGCGTCACCGCACGAGCTTCACGGAGCAACTGGACAATACGCGTAGCACGACGACATCTGAAGCGGCATTGTACCGC
CAGCACTCCCGCACGAGCACGAAGGAATCTACTCCGCGCGCATAACTGGCGCATCCTTGCCTGAAGCACTCGGGCTTGTTTCATCGCACGCATCCAGCAC
ACATATCGATAGGCACGACGTCCTCGCACACGGGCTTGGGTGGCAATCGTAACCTGGCGAAGGTGTCGGTAACTACGACGCGCCACAAATCCTCTAACAT
GTCTTTGAATGACAAGGCTGGCCCCCTGTCGTACAGTTACACGTAGATTTTCCAGCTTCTCGTATGGCTTGCGACGAAAGAAGACACGAGTTTTGCCCAG
ACTGACACCGCAGCGCATTTGGCGAGTctgctcgtcatcgtcgtcttctagATCACCTTGCACTTCTCCATCGGTCTTGCtatcagcaagaagaacttgt
gTGAGCTGATGTAAACACAGGTCAAGTTCACTCCAACTCCTGTGCCTCTTTTCAAAGCCATTGTCTGTCAATTTGCAGAGAGAAAGAAGCACGCGTCGAT
AGCGGCCAAGGAACTGCTTATGTGAAAGGCGAACAGGGAATCCAGCACGCGCTACTCGCACAGCTTCAAGAACACCGCCACTGCGTAGCTGCTCCACCAC
TCGCGTACTTTGGAAAAGTGATCCCACGTGCGAGTCATTCGGCTTGATGCAGCGCACGTAACGTGGTGTAGTGGCACGGACGGTAGTCAGCAGTTCATTC
AATTGGATCTTGAACTGCGTGCCCACACTAACCGCAGCGATAGCCGACTTGGCACGTCGACGGGTTCGAACCCCAAAGCCGTCCATATCActgtctgctg
ttgctccatCATCGTTCGCGGTGCCAGCGGCAAGAGCCTGAATGAGAGGATTAGAAGACCCGGCCAACAATTGAGCGGCACTCTCACAAAAGGAATCCTT
GTTTTTGGCGAG