Description :
From Genome Similarity Track
Location :
Scaffold_12:138740- 143179
Sequence
4439 bases(100 bases per row)
GGAAGACGCGGATGACACAATCCAGTCACGAAGAAAGACGTGTGCGTCGTAGACGCATAGACTGAATTGTTGATGGCAAGCTCCACCACCAACAGAAATT
TGCTCCAATTCGTAAAAGAATGGACGTACCCTCGAAGTATCTCCTCGAGGACACGACTGGCGCATTCCGTCTGACCTTCTGTTTCAGGATGGTCAGACGT
GGACATCTTTAAGCGCGTTACGAGTGTTTTAAACATGGAACGCCAGAACTCAGCTGTGAACACGGTTCCCGATCGGATACGAGTTCACGAGGCAACCCAT
GAAGGCGAAGGACTGCGTCTATAAAACACGAGCGCAAGCCGATGCGTTGATTGATTCAGGTACAGCAACCAGATGTACCATCTTGATGAAACTGTCAGCG
AACACAAGAATACCAGTATTCTTGTGAGAGTCTGCGGGAATCCGAAGACAAAGATAATGGAGACAGATTCCCGGCAATTGGCCGGGATGGGCAGAGGCTG
CAACGAGGCTAGAAGGGAAGGACTAAACTTCACCTATTGACAGACCTCATAGGCCCGAGCGTACTTGCTCACGAACTGATACTGGCGGGGCAAGTAAAAG
GCGCGGCTCACTGTGAGATATGTTTTCTCACGACCACGATGTCCGCAATGAGTGCGTCGTGGTACTCATACATGATACGTAAATGCAGGTCACCATGATC
TGGTAGGACGACACGACGTGTGTCGGGGCAACAGCCGAATACTGGACTAAGCCGTTTCGAATTGTATATCTACCCGTAGAGGATCGATATACTGTTTGAG
ACTTTTTCCGGATGGGTGCGAGAGATGATGCATCAATCACTCCAAATTCCCGGATCATGCGCCTTTCGTATGTCTTCCTATACGATTGACAACGGGACAC
TCGTACTCAGTAACGCGACAGTGGTTGGACCAGTGTCTGGTGTCTCAGCCGATTCGAAATCGGGCCGGCGCGGGAATGCGCCAGTGACGACATTAATGCG
TCCTGGTCTATACTCGACGGAAAAAATGTACTCCGCGAAGAATAACAGCCACCTCGCCATCCGCTGTGAGATATTTGGGCTGTTTACAGCCGTGCGTAAA
GATGCATGGTCCGTATAAACAATGAAGGGTATATCGCCTAGAAGATATAATCTGAATTTAACCAGCGCTTACTTCATGGCAAGAAGTTCCTTGTCATGTA
CGGGGTAGTTACATTCAGCTGGTTGCAGCTGGCTTGACTGATAACAGACGACATGTTCCGCATCGTTTGCATCGTACTGCATTTATGCGCAGCCGATTGC
GAAGTCACTGTCGTCACAGACTTGTGGAATGATCTGTCTTGATCTGCAATCGCCAAAACAGGCGATCGTATCAAGATCTGCTTGATACCTTCGAAGGAGC
GCTGACAATCAGCACTCCATACCCAATTCTTGTTCGTTATCGATAAACGAGAGAGATGAACAGTCATCTCGGCATAAATGCGTAAATATTTATGTAAATA
CACCACTAGGCCAAGGCAATTTCGAAGTCCCTTGACATATGTAGGCACCGGCCAGTCGGTGATCGCCTTGATATTTTCTGTATCGGGGCGGACGCCATGC
TTGCCCACGATGCAACCAAGAAGTGGTATTTTGCTAGCAGCAAATATATACTTCGTGAAGTTGGCGTACAACTTATGCTCGCGCATTAGTGTAAAACCCT
TCTGGACGTGGAGTCGGTGCACTTCCACATCCGTCTGCCCGTCCATAGCCCAGATATGAACGAACACATCATCAAAGTAGCTGGGTGCGAACTCTCTTAC
GAATCTTAACCGATTCGTCACACATCTTTTGAATGTGGCAGGAGCATTACTCAGCCCTTGTGGCATAACCAGCCCCTCACAGAGAATACCACTTGGGGTG
CTCACCGCTGTGTACGGGATGTCAATTTCACTCACAAGGATCTGATAGAACCTGTCCATCATATATATCGATGAAAAGATGGAACTCTTTGACATATCAT
CTATATTGACATCATTCCTTGGTATCGGCGTTTGAGCCGGTACAGTTGCAGCATTAAACTTATTGAAAGCATGTACTACCCGCCAACCTCCTGTATCCTT
TCACATACACAAGGTCAGAAAGCTATGTGGAGAGGTGGACTCCCTCACATGGCCGGCTGCTAAGCTATCTGCAAAGAATTCGTCGATCGCTAGTACTTGT
TCATGAGGCGGTGGCCCCATTGCTTCATGACACAGTACTTCGAACCCGGTTTCAGGTCGATTTCGTGACGAGAACCTTCGCCCTTAGGTAACTCGCACGG
CACTGTTTCTGGGAATACATCCCTGAATTCAACCAAATCATTGTAGAGAGGATTTGTCTTGGGCGATTCCCGCGATTGGGATGTATAACGCTCAATTCGA
GTCTTCTCATCAAGGACACTCTCGTCCATTGATGAGCTGCTGGGAACTCGTTCATCTTCGGCAAAAACCATTGCCGATCGGATATCACTGACGTACTCAT
CTTCCGCGACGAGTACGCAGATCTGCTTGAACTTGCCACTACCCAAATCACGGTTTACCGGGGGTAACTGATCTCCGAAGTTAACTTCGGAGGCGCAATC
AGATCAAGCGTATGACTACCTATGCTTGATCAGTCATTAACCACGACATTCAATGTCTCTGTTGTCCCTTGGGAACTTACTTCCACTGTTTGTTGGAGAA
TAACTCCCTCAACTCTAGACTCTCGGGCTATTTCATCTTCGTGTTGACCATCTTTGGCAATCGGTTGGTCATGCTCTGAGTGTTGTCCTCTAAGAGGCCA
AACATGCCCCGGTCCGCTCAACTATTCGAGTGGTGGACCCTCGGCGCTTCCTGCATTGTTATGAAGTCGCCGGGAACTTTCTCCACAATGTGAGGGTTAG
TCTACGATCTTGTGCAGTCGTACTAACGACAGAACCATACGTGAGGCCATCGCACTCACTCGTAGTACATTCACATGGTCGTGGACGCTTCAGGACGTTC
ATCAGATGGGCGTCTTTTTAACAAGCGTCGGGCTTATCGACACTTCGTCGATGCCAGCTGACTTGTGGATCGTACCTTCTGAGCCACTGTAAACCAAGGA
TAACATCAAAATTGTCATCCAAGCCCAAGACGATGAAGTCACCGTCGTATTGGACTTCTTTCAGTGTATAGTTAACCCCTACTACACGCTTCATCACTGT
TACGGATGCGCCTGTCGCGAGGCGTAACTTCATCCTCGTTAGAGGGATCTCTAGGTAGATAAATTTAAGCTTGCCATTGTCTATCGATTGGCGTCGTACA
AAGTTATTTGATGCCCAACAATCGAATAGGGCTCTTAGTGACATGTCCTTTGCCACTTCGAGCTTCAAGGTAATGAGGGAAACCTCATTATCAGATGCAG
TAACACACAATGATTGCGCGTTGGGAGAGATTCTCGTCAAGAGGCCTGCAAATCCACGCAACGTTGATGGATCAGTAGGGTGCTCCGCACCTACTAACCC
TGACCGTTATTTTGGTCGTCCTTTACGATGTTGCGTTTTCGCAATAGCGTTGGACCCACGCAAAAGACCCTTTTTGGCCGCTTGACGGTTACTGCTTCCT
GCGGTACGTGGTACCGCGTTCGGGGAGCTGCATTCGTATGCATAATGCCCTGGCTTATGACACGTATTGCATGTCTGTAACAACTCACCTGCCGAATGAA
CTAGCCCTGAAATGGATGGCGCTAAAGCGGGTTACTTATACTTTGCCGGCACCTATTGCATGTCTGCAATTTCTTATAATTCGTAACGCGAGAGCTTTCT
CTCTCAGCGTAACAGAGGCCCATCGGTTTTGGGCCTCCGCTTTCCTGTCGCCTCGGGGGGCGATAGGAGTTCTAACTCACGTGAGCTTGTTTCACGCTGA
AATCTTCTTGTTACGCAACTTAATTTGTCTCTTCCATGGTATAAAATTCCAACCGGAAGATAGGTCCTGACTGGACCGTCTGTGATACCCTGCATGAACG
TCGTGCTCAGCGTTTGTTCATTCGGCGGATTGGACGTGATCCACTCATAAGATGACGTATGTACTGAATGTATGAGTGTATATCTCGTTTGATTTGTTTG
AGTTTCAGGGGTTCAGAGCGAGCCCTGAACCCAGCTCGCGGCGGTTCAAATGTTTGCCGAAGCAGGTACTTGAAGACTTTTAACGACCCAAAGACAAATG
GATCGTGTAGCTTGAGGCCCAAGGCTCAAGTCTTCGCACGCCCTGCCAGGTTCGATTGAGCAAATGCGACCTAGATTTGCTCATCGACGATGTGACGAGC
CCTTATGGCGTCATCTAGATCAACAAACCATCTCAACAGATAATCTTCTTCAGTTGCTTTGTATTTGGAGATGTCAATCTTTAGAGATTCGGGTCGACGT
GTGTGTGTCGACCCGGTAGCAGCAGCCTGTTGCTGTCTC