Description :
From Genome Similarity Track
Location :
scaffold_16:138702- 156450
Transcript NameFunction/comments
g973.t1 conserved hypothetical protein
g974.t1 hypothetical protein PHYSODRAFT_358438
g975.t1hypothetical protein
g976.t1 conserved hypothetical protein
g977.t1hypothetical protein
g978.t1 serine protease family S10, putative

Sequence
17748 bases(100 bases per row)
GCCTGGACGAATAGGGGACGTCGCAGTCGACACGTGAAGCGCTGAGCAGAGACCTATTCGGCTGAGCAAAGCATTGGCAGGTTGATATCCACTGGCGCCA
ACAGCGGGACTGCAAGCCACCAAATTTCCTCCGTCGGATTCGACGAAGTGACCAGCGACTGATATCGGCAATGACTCAAGTTGCCGTGGATGGGCTCCGC
TCGAAGATCGCCGCCGAAAATCTAAATGACGCCGAAAAAGAAACATCTTATCCGATCCTGGCCTTCTGATTGGACCAGCGAGAAATTCGATGTTGAACTG
GATCCCTAGAGCTCTACTCAATGTTTGCTGCCGCGATGGACTCGACCAAAGTATCGTGCAGTGCAAGTGTTAAACAGGTCAACCCTGCGCGCTTCAGCCT
AAACCCCGCAGGGATATTGCCGAGCCGGGAGAGACGGTCATCTGGTGGTTGCCTCTGCCATTTGGTAGGGCTTTGGCAATTTGCCAAAGGCAACCTCGCT
GTTTAACAGCACCCTTGCCCTTTGTAGCTAATGTTTCTATCCAGATATGGGCTCGGGTATGTTGTTGCAGCTGAATAGTGCAAAGGGTAAGTTTTTTGCG
AACTTTAGTGGTCGTAGGTCTCAGACTGTAGGTGTGGACGAAGCAGCCTGTGGGCTGGCTTCCCCTCTCCCCTGCCACTTTTCGGCTTGGTTCCATTCTC
CAACTTGCGCTCGACCCACCGGGAATCGCCCCCATTTGCAGGGCATTTCGCTTCCCCACTTTGCAACTGCAGCAGTCGTTTCGCTCGCTCACTGGATAGT
GTCGAGAGCAACAAGAGCTGCGAAGGAGCAAGTGTCACGTCAACGAAACTGCTCTCGTCACCAACTGCAATCGCTCCGTCTCTCACCGGCGAAGACTTTC
GGCAACACTCTGCAAAAAGTCTTTTCGCTGGTACAGTCCCAAGTTGCCACTTGCCACGGCGCAAAGATAACCCCAGGCCACCGTCTCACTCCTCCATTGG
CTTGCCAAGCGACACCGCGCCAAGAGGCACCTTACACGTTAAAGTGCGATCCGCCACGTTCCCCGCCACGCTGCCAACCACCGGCAGTCAAATATTTTAG
ATAAACGGAACCCAACCACAACGTCAAAGCAAAGGTGATGCCACTTTCCATCTCGTTTTACCACAACAAACGCGGGGAGGGCGTGGCCAGCTCCTACCAG
AGTGTGGCACTGCACGACAGGGAGAAGGTCAAGCACAAAATGGCGTTACCCAGCGAATTTTATCGCAATATTTGGGGTCCGACCGAAGAGGAGGACGTGG
TGCTACGGCGTCGGGCCCGATCGAGCAAGTTTGGCAGCTCTCCAGCCTCGGCAATGTCGCGCAAGTTCAAGAAGCGACTGGCAACGGGCCCCCTCGTCGA
CATCTCGCAGGTGGCGCATGTTGTCACGACAATGTCGGACTTTCGCGCCGACTACGGGGAGGACTCCAAGATGGTGAGACTCGTCAACATTTGGGACGAC
CGAAGTCTCGCGTTAGGATTAGAACCAGAGTCCGGCTCGGACAAGTCGTCAAGCAGGAATGAAGGCAGTGAACAGGGTCCTTCCACTGCGGATACCGAGC
CGGAGGAGATCATGTCGCCCATTTGCAGCAGGGCGGACAGGATCACGGAACTCAGTTGCGAAGACAGCGACGATGACCTCAGCAGCTTAGCGTCGTCCAT
GGTGAACCGACATTGGCCAGGTGAGCTAAAGCGAACTCAAACGCCTGAGATTATTTTCCCAAGCACCAAGAAGAACCCTCGTAACAATGGACGTGGTAGT
GGCAAGTCAGACAGAAAGGAGCTCAACTTCAAGAACTTGCCGGTGCCTCCTCCATCGTCTAACAACGGTAGCATCATCTTCAGCGCCGTCTTCTCGGAAC
AGCGGGACTGGAGTTGGAGCGCTAAGTTCCTGCTGGGAATCCACGAGCCAATTCGCCACGCGCTTTTCGTCATGGATCGGTTCTTAGAGCAGTCCCAGGG
TCAATCCAAACCGGAAGCTTCGCACACGTTGGCTCTGGAAGCCCACGTAGCAGAATTCTTTCTCTGGTTCAAGACGTATTTCGTGGAGTATTTGCTGTGT
CAGCATGAGGTGAAGGCTTCAGTGTTGTTGCCAATGCTCAACTTGCCAGTGTCAACCAAGCAGCAGATTCTTGACGTGTATCAGGATATCAAACAAATGC
TGGCTCAAATTCAGCAGCTGGAGCGAGCGTTATGTGTCAGCGGAGCATGTAGTGCCTCATCCTGGCTACTACGACTTCAGGTTTTGCAGACCGAGATCAG
GCAGCTCAACCGAACTCTGCATGCAGCGTTGAACATGGAGGAGACCACGCTTCACTCAGCCTTGAGTGCTGCATTCACCGAACGCGCTTTCCGAAGCCAC
ATCATGCCTCGAGTATTCCGCGCCATTCGAGCCAAACGTGTCGTGGTGCCGTGGATTGTTGAGCGCAGTAAGATTTGGGGTGGAGAAACTGAGCAGCGGA
GTATCCAGGGTATGCTGCCGTTCTCAGCGAAGTTCATGTACCGCAAGATTTGGCGACCATATTTCATGAGCAATGTTGCAGTAGCCATGAAGAACCTCAA
CGAGTTCGTCAGCAGCGCGGACTCGAACAGCAGCGCCAGTAGTGGATCGGCCTACAGCGAACGCAATGGAGAGATGTGCTCCATCATGTGAACCGCCATC
GGGTGGCAGTATTTCGTTTTCTCATTCTTGAAGCTCTACCGCTATTTATTATGGACCAACATCAACTATCTCAAGCGTGTACGTGGCGTGACCTAAGCAA
CCAGAGCTAAAACGTTTAAGCAGCGAGTAGAAGCAGCTTACTCATAATCAATGAAAATGCTTTCTAACTCATAAAGCGAGAATTGGCATTAGACGTTTGT
CAGACGATCCCACCTAAATCCAAAAACGGTTGTTCAAAACCGAAACAACGGCCAAATTCGAGTGTTGGCTGTTGGTTTCACAGTATCCGGGTGATACGTT
TCAAGCAGCGGAGTACATGTAGTTCGAAGGGGAACACACTTCCGAAATCAACAAGGAAACGTGTCAGTATGACTGCGAACAACAGAAAGCAAACCATGAA
CACGGCGAGCCAGGAGCCTGAGCAACAAGAAAATGACACAGGCACCAACAACTCGAGTGAATTTCAAGAAGCCTCTAGGGTTGTATGGGACTGGATCTAT
TGGTCTGGTGCAAAGGCGTTTGACGGCATGGACTTCGCGGGCGAGGTGCTGGCGAATTTTCTAGGGCTCAATGAGTCCAAGTATCAATGGATAATTGATG
CGCAAGAGCGTGAAGAGGAGGAGAAGCAGCAGCGGCGACTTGTAAAACGCCAGCGACGTCAGCTTCGGTTGGTACAGCTTCTAGAAGAAGAGCAGCGGAA
GCTTCAGGAGCTAGAACTTGGTGCGCGAGAGCAGGACACTGCTTTAGTTCAGTAGAAACAGGCATCGACTGCAATTGGCAATAAACTCATCGTAGGCTTT
TCTAGTTTTCATGCCAATGTCACCTCGATTTGACGCCGTTAGTGATATTAGCTCGACTCTAGAAAAAAATATACGAGAAAATATCAGGAATAGGCAGACA
GACACCTTCATCTTACACGTTGTCTGTGTTGTTGACGCTATCCCATAACGGATGTCTCGGCGGCTTAACCCCAGCGCGTAGCAGCATTCGCACGGCTGCC
TTTTCAATGCGCTGCAGCTGTCGATTCACGACACTTTCACTCTCAGGCGTGAACTGCTTCGTCCGGATCGTAAGAAGTCCTATCATACACAACATAACAT
TCAAATAAGCACACGACCTATTCGATATCCAGCGATTCAAACAAAATGCATCTCACCATTGAGGTTGCCGAAAAGCACGTCGGTCGAGTACCGGTCGCCA
ATCACCACAAGTGACTGTGGATCCACTTCGCCAAAGTGCTTCTTGACGAACTCCATGCCTCCAGGTTTCTGCAATTGCAAGCGCGTTTCTTTCAGTCTAC
GCTCCTTCCTACCCAACAACCCAGAACCCAAACTTCCACTAATACCTTTTGATTATGGCGAAGCACCGCGACATGCAATCCCTCCTCGATCTTCTTCGCC
TCAATTCCGTCCGTGTCGTCTGCTGATCCTGCTGAGTTGGAGAAAATCACGACGCCAGAGTCTCCAAAAACGCGTCTGCATTCAGCCAGAGAGGACTCCA
GGTGGGGTGCGATCTCTAGTTTGTGTGGCACTGTTAGCGTGTTGTCCTTGTCGAAGATAATGCCGCGGAACCCGCGGTCTCGGAGCGTCTGAAACGGCAC
CTCCGTCACATCTGAAGTAGAAATGAGGGACGTAATGTCGAATTGGAACAGTTTTGATATCAGCATTTCACAATACACAGAGGGAAGAAATTAGTAAATC
TTGCATACACTGAAAGAAGAGATGACGTAGATTACCTTTCACAGAGAGTTGCGGCAACAAAAGCTGCGGTTGCCGTGTCAGCACGCGGCAGAACTCCACC
ACTCCGCCGAGGTTGAGTCCTTTCATGTTGACCGTACAACAAAGGGCTACAAACATTTCCATCCAATCCCATCTCTTCTATCGTTTGATTCGCCCAAATA
TTCATGAGTATTTACCAATCACAAGGAATTCACGTCTACACAGCCGGAGAGCTCGTCAGAAATACTCGCTCTTCGTTGCCATCAAGACGCGGAGTTGTCT
TCTCTTCGGGGTCGTGTGTAGCCCCGTAACGCTTGCCTCTGTTGCAGCTACCTCCAGAGGATTATCAAACTGCTTCTCACACTCATAACCCCGCCTTTTG
CAGCCTCTAGATCCCCATAATGGCCGAGAATCCGCAGGAAACGCATATCAACGAAGAGGAGGACAAGGCTGAGAACTCGAGCTCCGACGACGACTCGTCT
TCTTCCAGCTCAGGCTCCTCTTCTTCCTCTTCTTCATCTGATTCTGAGTCGGAGGACGAAGCTGAGACTGAGAATGCCAACGCCGACGCCGACGCAGCCA
AACACGCCAATCCGCACGGAGCCATTAACAACCGAACAGGCCACGGTTACCCTTCCAGTACAGCGGGGCCAGCTTTATCCGCCCCTCGTCCTCATGGACT
CGCTGCTTCCACTAAGACACTAAACGTTAACTCGACGAGAGCGGCGACCAGGTTTAAAGCTTCGGAGACACCTGAGTCGATGATGCCTCTGGGCACGCGC
AAGAGAGACCGACGCACCATTGAAGAGATCCAGAGAGACCTAAGGGACAAGAGGAAGAAACCACTGGGCAATCCAACAGCCAAGTCCAGTCCTCCGCCAC
CGAAAGGTTCGCCAGTGCGTTCTCCTGAAGCTGAAGCCGTACTTAACAGTGGAGCTCCAATGGCTGTGGGAGGACCGCTGGGAACGTTTGGCACTGCAGG
ACGACTACCGGTTAAGAGGAAACCGGTATCGGCACATGATCGGTTGGCGATGAAGCTCAATGGAAGAAGGACGACTAGTGCCAAGGTGAAGAAGGCGACC
AGTTCCACGGCCGGAAGCGCCCCAATCCCACCCGTGTCGGTGATGACGAATAAAACGGTTACTAAACCCATGACAGCCACGAGTTCGATGGCCATGGCCA
CTGGGAATAGTAGCAGCAGTGATCATGGAGGGGACACTGGAGGCGACGGATACAGTAGCAGTGTCAGCAGATCGTCAGCCCCCGCAGTGGATGGGAAGGT
CGTGAGAGCCATGCTGCGTGCTATGCTTCGGTATGGAGACCTGACGGATGTTGGTCTGCACCCGACAGCTGCCAATTTTGCTGACGAGTACAAGATGCCG
AACTTTATTGAGCGAGCGAATCTGCTGACAACCACCAAGATCTCCCTCGACCGTTTGCAAACTCTTGCGAACGAAGTTGCTCAGAAGGCCAAGCAAGCGG
TTGAGGCTCGGCCACCACATGACAGCATCAAAATCGCTGAGGTTGAGGCAAGATCATCGCAGATTATTGAGCGTCTTTACGAGAACCTGAAACTCCGGGT
CGCTGTTCAGCGTGCGTTGCGTACAGCAGGGTGCTCTTCTGGCAACGCACAAGCGAATGCTCAAGGGGCTTACGTACTAGTGGCGAAGCAGAGCGATCTG
TCGGTGCTGGGTGTCAACGCGAGAGACTTGCCCAACTGGACGTGGGCTGAAAAGGAACATGATTGGACGCAGCGGAAAGATGCAGCGCTGCTTCTTGGCG
TTTACGTCCACGGATTTGGAGGTTGGGAAGATATTCTCAACGATGATTTACTTCACTTCCAGGGACAACGTGCTTTGAAGGGTGAGCGCTTAAAGAAACG
AGCTGAGAACCTGCTGAAGCGAGTGCCTGCTCCAGACCTTGACGCTGGCGACCCGCGCATTGTACAGCAAGCGAGTTCCCTGGGCTCCTCAGGTGCTAAC
TCGAACCAGTCGTTAGGGGCGCAGTTTAGTGCTATCATTCACAGTGGGTCCATCCCTGGCGTGACGGCATCAATTCCTGCTAATGCAGGGCGGATGGCTC
GAGCTGCAGAACGATTTGCGGCACGGCAACAGAATGGTGAAGATGCTACAGGTCGACGCCATGGTGGATCTAGTAATGGCGCTAGGTCGGCTCATGGCCA
GGGATTAGACTCGGAACGGCAAAACAGGACGCCACTGTCGAGATCCCCAGCACAAGCCAGCGTAGTCGATAACGAGCCGGAAGAAGGCGAAATCGGCGGT
GCTTCACCGGCGCAGTCAACGTCGTCGCGGCACAAGAGGCGATCGTCATCTTTGGAGGAGGAGGACCGAACGTCCCGGAAGAAGCATCGCAACAACAGCA
TTGAAAGCTCGTCCAAGAAAGAAAAGCGGAAGAAAGAGCATCGGAAAGAAACGAGGACTAGTGAGACCCCAGCGGTGGTGGCAGTGGCAGATGTGGCGCC
GGTGCCGCTTCTCTCTACTGACGAGTGCAATGAGAAGTGGAAACCCAACAAGAAGCTGCGTGAGATTCGACAGGTGCTCAAAAAGATGAAGATCATGGCT
GAGTGGTCCCGCAGCCAAAAGGATGAGACCGTTGTTGAGAAGGTGTTCAAGTATGTGAGTACAATTGGAGAAGCGATCGACCGCATTGTGACACAGCAAC
AGGATGAACTGCAGCATTCGGATACCTCAACTCGTGAAGTCGATGAGCTTTGTACTTGCCTATGGACGTATGCTGCCGGCTATACGCCTTTCACGCCGCA
GGGTTTCGAGCGGCTCTACGACAACATTTGCGCAGACGCTGATGCTCTTGTCGCGTCGAAATCATGACGATCCACAGCCAAAAAGTGACTCCAGCCTGGT
GCATGTACAGACAGAAGTGTGGGAGACGATAAACTTATGAACAAGGACGACTGGATTGCAGATTGTGGTCAAGAAGAGTACATGACGTTGGTTTGTTTTG
AATGAAACGGCCACAAGGCTTGTGACCGTTTGCACTAAGTGTTAGAAATTACTGACCGATGTTGTCTGTGATGCAGCCGCCGCCCACGGCCGAAGAGTTG
GCGCTGAAGGAGCAAGTGACGCAAATGCTGACGAGTCACGGCGTGCTAGGTAAGCTGAAGGCCGAACTTCGCGCCGCGGTCTTCGAGGTAATGCATGAAC
GCGAAGGTTTCGTAAAACCAGTTGACCCAAAGGCTCCAAAGCTGAGTGACTACCCGATAGAGACCAGGACAATCGCGTTGTCGCTTATCATTGAGTGTCT
GCGTTTCTTCCATTGGGAGCACGCACTGCGTGTGCTGTTAGCAGAAGCCAACGAAGAAAATGAGCAGCTTGATGCTGCTCAACTGGTCAAGAAACTTGGC
TTAACAGGAAGCGGATCCTCGAAACCGACGCTTTTCCAGCTGATTGAGTCCAAGGCATCCAGTGGAGAACAAAATCCAGCTACTCAAGCAGTAGCAACTA
CGAAGTACGACCAGTACGACGAAGATGAAGACAAAGATGAAACCCGTTGGCCAACCAATCCATCAGTACCGGAAGCGAAGTCTTGGGAACGTGAAGAGGT
TGCACTACAATTGCCTGCAAAAGTGACTGACGATTCTGAGCAAGACGCCAAGGAGGAAGCCAGGGATGAGGATGGAGAAAACAGCGCTGAGATTGAAGAG
AGTATGGCGGAAGAGGTACCTAGTGGCTCCGAGCTAGAAGAATCGAATTATACCAATTACGGTGAGGAGGAAAGCCAGGATCGGAGTACTGAAGCCAGTA
AGCAGCCTCCCACCCCACTTTCCACGGCGAAGTTGCAAGAAGAGGATGAAGATGGCGATGTGGCCCCAAGAGATGGTAAGGATAACCACGAAAGCGACGA
TGAAGACGAAGTATCGTTAGCAGAGCCGCCTCCAGCCCCAACGAAGCTGCCATCCTTACCGCCGTTGGTTACAGCACCAACCAGCACTCTTGCAGGAGAT
GCGGAGGATGATTTCGATGCGGTAAGCTCGATCTGAGATCATTGCGATTTTTCTGTACTTAAATTTGCATTTTTGATCGGTATAGGAGGAAGAGGCTGAG
CGCCTAAGGAATCTGGACGCTGCGTTGCAAGCCATGGAGGCTGAAGATGATACTGGTACCCTACAGCAACTAAAGGCTTCTCTACAAATGGAACTGCGAG
AACAGGATAGTCTTGTGAGTAGTGGAGGGCTGGGGAACGCGGAACGTGATGAAGAAGAAGCTGAAACAAGTAAGGCTGACGACGATGGATACGGAAGCAG
CGACTTCGAGGAGGAGGAAGAAATTGCCAGGTACTACATGTAGAAATGTTTGGTAGATTTCTCTCGCTGTCGTGATTGATACTCACATAGATCTCTGTCA
GTGAAATTTCGGAGGAAATGGAGTCCATGTCGGAGCTTTCAGACAAGGAGGACGAGAGTGAGGACGGAGCAGTTGAATCTGCAGCAGAAGCGAAACCACC
GCGCGCTCTTCAAAATGATACCCGGGTTGATAGCGAAGATGCGTTGAACAGCTACGACTACATCGAAAACGTTGAGAAATGGTGAAACGCTTCTCGAACA
ATAGATGACAACTCAGTGAGGATGAATGAAACACGGGAAGAAAGCAAGTGTAAGCGTGTATTCTAGGAAGTGCTTGACCCAAGCGCGAAGTTGATGGTTC
TTACTTGCGCTTTCCTGCCCCGACGAGTTTCTTCAGCAGGTTCTGGTCCGCAAAAGCTTCTGGGTGGATGAAGTAGTGCCGACCACGTGCCTGGAAGGAC
ACCATGGGGTGCATCGCCTGGGTAGGAGGCGACACATCGGACAACTTGAACGAGTGCTGCTCCAATTGGGCGAAGAGCGTCACTGACTCGACCGTCACAG
TCGTATCGTCCTTGGTGTCCACGAGCCACATCCGCATCACGTACGGTTTGAACAGGTAGTGAAACAGCGACGTCGAGCCCAGGCCGAACAGCATGATAGT
GCCGCACATTGCCCACTGCAACATCAGATAAGCAAAAACAGGAACAGCGGCTACATCAGTACCTTCACCGTATATCTAAACATCTTTATACATCTGCATT
ACCTTGCCGATTGCCGACGTGTCCTGTTCACTGAGGACACACAGAATGGGCATGCCGATGGACGTGAGGGTGCAACTGGTTACGGATACGGCCTTCATGA
GGCGTACGGCGCGCGACATGGGCGCTTGATACACCTGATCCCCACCCAAAGCCGTAGCGCTCTCCAGTAACTTCTCTACATCTCCCTCTCGCGCCTTCTG
CGCCTCATCATCGGGCTGGGACGAGCTGAAGTGGCGAACTGCCAAGGGTCCCTTGAATCCAACGCTTCCCCGGCTGCTGAAGTCGAATGAGAACCGTTGA
AGTGCAGCTGCTTTACCAGGACGAGTTGCAATGCGAGAGGCAGTGCAGAGCGAGCGAAGAGAGGCTGGGAACGCTGTAGTGCTGCGCACCGCGCGACAGG
AATTTCGCAACACCAACATGTCTGCAAGCCGTTGACAATCTGTGGCTTTGGAAAGCAGCGCGATTTTTTTTAACCAATCATAGGCTAAGCACTCAAATAG
TGGGCGGTTTAAGGGTTAACGCTTTGATTGGGTCAGATACCGATACAGACAGTTCTACAGTAGTGTACCGGTATCTGTAATCGGAAATAATCGAATGTCA
TGGCAATCGCGGTGAAACAGTACCAGTTGTGTATCCAAATCTCGCAAAGGCAACGCTACACAACATCGGCACAAACGCTCAGTTATTTCCATGTTGCCGC
TGAGTATACATTAATAAAGACAGAAGACCTGTATGCCGAGTCAATGATACACAGATCAGCGCCAAGGGATCTGGTGCGTCCACAAAACAGTTTTAAATAT
GCTTGTTCTTCGGCGTGTCAGAGGCGACCTAGATGCACGTTGGCGGCGGCTGACCACTTTGCAAGAATAAGACTGCCCCGACAGTCTGCGGACAAAAGTT
TTAAATGTATGGGCACGATGCAACCTCGACCTGCTTGACGCTTGACATGGACTCTGGGCCAATGTTTGTCAGCAATACAAACGCTACTTGGGCTAAGCTT
TTGCCACAGTATTCTTCTCGTTTAGGTATGCATTGTCGGTCTTGGAAGGTACTGTACTGTATCAATCCAAATGATATCTGTAGTTGAAGATAACTTAAAC
GAGGTCAAAGGCCTGACGCATACCACCGTTCTTTGCGCTTTTTGTTTTGTTTCTGTGCACGTTATGTGGCGTTAGTCACCATCTGCTGCTGACTAAATGC
AAAGGTCGCAATGTAACACAATGCACAATATAAAACTGAGCGTTCATGTGAGCAAAGTAGACCAGTATCGGCACCATTGCGAGGGTGTAGATGTACATGT
AGTCAAAATCCTTGTCAATACTCAAGATGCAACTTATCTTGACTGTCAGATGCAGGTCTGTACCTTCGGAACGGAAACTTTTGAAATATGGGAGGAGGCG
GATCTTGGGGAGACAGGGACTTCTTGGCGCCACCGACCGTACCGAGTTGTGACCCATTCCTGCTCCTTCGATATTTTTTTTCGTGTCCACACGAATGTAT
CGGCAATGGCAAAATGGTCTGCTCACTGTGGTTGCCGGTCGTTAATCGAGTGCAATTCGCATTGGCACGCCGCCGTTAAAGTGCAGCTCCTCTAAAAACA
CACGCAATTATTCTTGGATGTCTTGGAACTTGCATTTTTTGCCTTCCGCGGTTTGATGGTGCAGCTTCTTTTCGCCTCTGCATTCCAAGTTGAAACGCGC
TTTCCCTCGCGGTTTTTGTCCAATTGCCGGTGAAGAACGGCGGACGATACCCAACGCAAGATAAACGCCTTGAGCCCAGCCGTCCACAGTCTCCACCCAT
ACGCGACCCACCCACTAGCTCTCTCGCCTCCACAGAGCCACTTGCTGGCGGCTTGGGATCTCTCACCGATAGCTTCACAGATGCAGCAGGGACGCCAGAC
CGGGAACGCGGGCGGGGAACCCCGACGCTCGCTTACGAGCCCGTTTGCGGTCCAGTCGGGGACTTCTTACCAACCGACGAACTTCCTGCAGTATCCAGCC
CCAGTGGAGCCTTCCACACGTAACTACAACCAGCAGCCGCCGTCGGGGCGCTACTGGCAGGCCCCATCTGGGATGGACACTTCAAGCTACACGAAGCAGA
GACGCCACGCTGACAGCTTGGACTTGGAGGAGTTCGGCGGCATTCTGGACTCTGACTCGACCTCAGTCGGCCACGAAGGATCGACGGCGTCGGAAGCAGC
GCCCGATATGAGCATGCCCAGCTTCGATGTGCACCCGCTCCACGATGGGATGACGGGGTCGGCTGGGTTTCACCCTACTGCAGCCACAGCGAAGCCGCCG
CAGACTCACTTTTCGACGACGCCAAAGTCCACGAGGACCGTTCCACCTTCGTCTGATCCAGCTACCATCGCTCTGGTAGACGCCGCGTACACGCATTTCA
ACGAGTCGTCCACTGAACCAGATCTGAGGACAGAAAAACTCACCAAAGACAACAGGAACGAAAGGTGCCAATATCCTGGCTGCCCCAATCGGGCTCGAGT
GTCCCAGTCGTACGGCAGGTTCTGCAATCGCCACGTGATCGTATCACCCTGTGGCTTTCCTGGATGTCGGGAGAAGGCGATGGAGCGGACTGCAATGTGC
GTGAAACACATGGAGCTGGGTAAGGAGGCACTTCAAGTGATCTTGGATGCGCGCACACAGAATGTACCTGTGTGTAAGATGACTGGGTGTTTCAAGAACG
ACCAAGGTCGAGGGTACTGCCGAGGCCACGAGAAGTTGTTGATGGCTACCGGCCGTCTACCTCCTCATATCAATAAGCGCCGCCTCAACAGCGCGTACAC
AATGTGCAGCTATCCCGAGTGTACCAAGCATTCTCAACGACATCATCTGTGCCGAACCCATGGAAATCTTATCAACAAACAAGCTCAGGAACTTGCGGAT
CGCCCTGGAGCTACGGAAGGTTTCGAAGAAATACTAGGCAGGATGCAGAAAGAGATGCGACGTTGTACCTACGAGAATTGTACGAAGAACTCGCAGCGAG
ATCGACTGTGTACGACACATTACTACGAGAAGCACAATCTGCAAAAGGATGGCTCAGCGCCAGAGACTTCTCCAAGAGGAAAGATCGGCTCAAGGCTATC
CAAAGCGGGAACCAGTGACAGGAGTGATGTTCGAGCTGTTGAGCAGACTCGTTGCGGGAAACCTGGCTGTGGGAATTTGTCGTATACGGCGGGGTTGTGT
GTGGAGCATGCGAAAGAAAACCAGAGCTTGGTTCAGAGTCAAGGGCGCTATGGAGATCTTTTCTCGTCTGGGGAGAGTGGCGATTTCTTTGAGGGCAACG
TCGAAAGCGAAGCAAAACCTGCAATGTTAATTATGAACGAGAAGTCCATGGATGCTTCTCTTTCATCCGGTGTGACCGCTATGGCAAACGCTACTCATTC
GAAGTGCACAAATCCGATGTGTGATCGAGAAAGCTACGGTCGGGATTATTGTGAAGCATGCCAAAGACTTTTCTCGCCGCTTGTGGTGTCGATAAATCCC
ATTGCATCAGGATACGCGTCAAGTGCAGCCACTGTTCAGCCTGAAGAAAAAGGTTCCTTGTGTCGCGTGAGCAATTGTGGGCAGGATTGTGCCCGTGGTG
GGTTGTGTGCAACTCATCTTCGAGCTTTCAGAACAGGATCGTTATCTGTGGACAACTTGAAACTGGATTCCCATGCTCAGCAGCAACGTGAACAGGAGTT
GGCGGAAGCAGCTGCCGTCGCGGCTGCAGCTGCTGCGGAAGCGAAACAAGCGAGTCCTACAGCGTCTGGTAAGTCAAGGAAATACTACTGCAAAGTTGAA
GGCTGCGGCAAACAGGCACAGAAACGAAACTTGTGTAAGCGTCATTATCGTCTGCAAGAGGGAGTTCCTACAGGGAGTTCCCAGGCAGTTGCTGCAGCCC
GTGCATTGCCATCAAACGTCATGCCTCGGGTACCACAGCCTGAACCCTCTCGGCCCAGTGTAGCGTGCCAGTTTCCAAGTTGTTCACAAGGTGCCTGCGG
CGGTTCTGGGTTGTGTTTGGCTCACTCCAAAGCTACTTTTTGCTGGCAACCGGGATGCGAAAACCTCGTGGGCCAGAAGCAGTTCTGCGAGTTCCATGCC
TTTAGGCAGCAGTGTGCTTACGAAGGCTGCATGTACACTGCCCAAAGGGGTAGCAGTGGCTGTGCGAATCACATGATGGCTCGTAGATGTCGTCACGAGT
TTTGCGATAAGTTTGCGGTGGGCTCGGATAGCGACTGGTGTCGATTGCACCAAATCAGTTGCCAGGACGCTCCCTGTGCGCTGTGCAAGTTGCATTCGCT
ATCTCTGGATGGATTTGCGCCAAGTGAGAACGTGAATACCAATCGGAGTCGGTACACTGCCTCCTCGAAGGGGGTGAATCCTGCTGGTGATAGCGGCGGC
AACATGTTTGGACGGAATGCACGCTTGATGTAGATCGGAAGTGCATTAATGTATGACCGGAAAAATGTACATGTAGTCGATGTAGCCATGCTCACCTCAT
TGCCATGCAAGAGACTTCAGGATTCCTGAGCTCTTGACTCACTGGATGGCATTCAGTACCTTCTCAAGTACCGGTATACTACCAGTTTCAAAACCGGTTT
TGTACACAATATTGTGTGGTACACCAAGGTCCATTTTCGCCATCCCCGTGCTTCAACTCGACGCACCTGTCGTCGTCATCGTCTCCGTGAGCCAGGAAGC
GCTCGCTCTTCTATCCGGCCTCCGCGGCGATGGAGCGCATTTACTCGGCCTTCTTCACGACTGAGCGGCGGCGTGAGCCACTGAAGCTCACAGCCGCGGC
GCTGGAGCTGCACAACGAGACGCAGAAGTCGCAGAAGCATCCGCCGCTCTTACGTCCAACAGGCGACGGCGGCAGACGACGGCCTGATGCAGAGGAGGAA
CCTCTGCACGAGGCCAAACGGCATGCAGCAGCCAGACGCCAGGAGCTGCACAAGATGACGATGGACTGGACAAGCGTCAAGAAAGATCTGGAGGCGGCGT
GTCAAGCCGCGGCCAGAGCTTTCCTGCTCGCCTACGGAGCCAAAGCCTTCACGGCTGTGCTGCTGGCCTCAAGGAAGTGGAGCAGTCTGGAGTACGGCTA
TGCAGATGCTGCCAGGCTGCTGCTGAAGGGAGATACACTCCGTTTCGGAGCTTTTTTCGGGAGCTTGGTGGGGATCTTTCGAGTGACGGAACTCGTAACG
CGAGCAGCTCGAGGCGGTGAAAGAGATGCTGTCAATTTGGCCATTGCTGGCGCCATTTCTGGGTCGGCTTTACTGCTGGATTCGCCCTCCAGACGCAACA
CGATCTCACTGTACATTTTTGTACGAATGCTGGATGTGGTGTGTCGCCATTTGATGTCCGTTGGAGTTTTACCGACGTGGCGCTATTCATCCGAAATGCT
GTTCGCTTTGAGCAATGCTGCGATCATGTATGCATTCATCGTGGACCCGAGTCTGCTGCCGAAGGTATGTCTACTGGATGAATGATGTTGAAGAAAGTTG
TGCATTGTCTAACGTCCGTTCATTGTTTTGTTCAGGGTTACTACCAGTGGATTTGCCGAATTGGCGCTGTAAACCATCACGGATTGGAGTACACTGTACG
TCAGCGGATGCGTGACCAGCTTGACACGCATGGAAACCCTTTGTCATTTCGCCTGTGTCAGCCCCACTATCACATGTACGCACTCACTCAATCGCATGAA
GTTGGAATTTTCACGACATTGATGCATCTCTGTGTACCCAATTGATTAGGGAGTCCTGCGTGACGCATGCCATTAAAGAATGGATCAACGGATTGGGGAG
GTCAATGCAGATCTACCTACCAGTCCACTTTCTCCCTGCGATGTTCTTTCGCTTTCAGCAGCTCCAGGGAGCTCCAGTGTCTACAACAGCACGGATCTCT
TATGCAGCGCTTTGCTCATCGGCGTTTCTCACGTCATACCAGGTTAGTGCATTGCATGACTAACGCTACGACAACTCCAAGTAAATACTTACTTGCTGCG
TGTTTCATCAGACGGTGGTTAAACTGGTAATTTGCACGGCCCGCAATGCGTTCCACCGAGACTTTGCCGCAACATCGCTCGCTGCTGGGGTAAGTTGTAT
TTGTAGTGGAAATTCGATTTGTGCTGTTGTTCTGATGCCTATACTCTGGCCAGGTTGCAACCGGTGGCGCTCTGTTCTTCGAGCACACCAAGCGCCGCTT
TGAGTTAATGCTGTATTGCTTTCCACGCGCACTCGACATCGTGTGGCAACTTTTGAAGCGCCGGGGGCTTGTCCGCTATGTGAATCACAGCGAGGTTGTG
CTGTTCTGCCTGTCCATGTCGCTCATCATGTCAAGCCCAGCGCGTTATTTCAAGCCGACGTATCTCCGAATCCTACGATTCATTTTTGGCGGCGACATCA
TCTGAGAATCTCTATCTTCCTTCACAATTACTTTGAAAAACTACGAGCTTCATCGAATTTCAAATCGACACCAACTTGTATGGTATTTTATTCACTCATC
GATCCTTTAGTTACTCCAAGTCGTTGAGCACAAACAAATCAAGCATTTGCTTTGCCTCCTCAGGCTGCGTCATCGGGACGAGATGTCCCGCTCCCTTTAC
AGTCACATACGTGATCCCTTGGAACTTCTCCACAAAGCCCCCAGTTTGCTTCGAGTCTCCCTCCGTGTACGTCCAGGCTGCGCGTGGTGCCAATCTCGGG
AGACCCAGCGACTCCACTGCCCAAAGTCCACCCAGAGCGTTGCAGACTGCGTCCGAGTCGCCGTGGTAAATGACCCCTTTCACTCCGCTCTCAAGCAGCT
GGCGCCACAAGGGCGTCACTTCAGTCTTCAGTGTAGGCGTGTACTTCAACATTTGAGGGTGTTGCAGCATCGGGTGATCAACACCGAGGATAGAGCCAAG
CGTATCCATAGTCGCCGTGGTCAGAGCGTCGGCACTCCAATGTGCAAGCGCTGGGTTTGCGTGCAACGCATCACGGACATCTGCCAGGTTGAAGTACGAC
TCGAGGTGTTTATTGTCCAAACACAAGTCCAGTGTGTTGCCAATCGGGTGTGGCAGCTTGCCAGGAGTCGACGGCGTCAAAATCTCCTTCACAAGGCGCT
GGATATCCTCCTTGGGCGATCCAGCGCACGAGCCGTATACATTGTACATGTTGATGTGGTCATATATCAACGTGGTGAAGATGTCCGTTGTCGCTGATGC
ACACTCCGAGCTACCATCGCTGAGCCCTGGTACGATGAGAGGGCTCTTTTCAAACTCACGGAGGTCGGGGCAGCTGGCTCGGAAGTTCTGGTATATCTCT
GTGCTCAGCAGCCCATGGTAGTACGCGAACATTACTGTCGACAGTCCGATGTACTCGCTCACACCGTTTCCCACCACAAACTTCTTCAGGTTAATGTGTT
GCGATTGGTCTGGTGTGGCCGCATTGCCCTTGAGAATGGCAAGCGCTGTGGTCGGCACATAAACTCCTCCGTAACTCTCTCCAGAGACGACAAAGTCGTT
CTTCCTTAGCCAGGGGAACTTCATGTAGAACTTCTGCAGTGCATCGTACAGATCCTGAGCCTGAGAGAGGTCGTCAGCCTCGTACACTCCACTGGAATTG
TAGCTGAAGCCGACACCCACCGGAGACTCAATGCACAACAAATTGGCCTTCTGGTTCCACGCCAATTTGTTCACCCGGAGGGTCTTCCCGTCCTTATTGA
CCAACAGCGGTCCGTTCTCAGAGAAGCAGCCCGAGAGGGAGCTGGCGCCAGGACCGCCGTTAAGCCACAGTAGCACGGGGTCTGTCTGGTGTGTGGAGCT
TTGTGACTCGGCTAAAAAGTAAAAGGCGTTACCCCCGTTGTTTAGCGGCAAGTAGCCCGAGAAGAGCCGCGATGTGTACTCGCTGGGCTTGCCCGCGAGC
GTTAGAATCTCGTCGATGGAGCCTGGGAAAGGTTTGCTGGGCAGTTCCGGTGTCTCGGCGTCGGCTGAGTCCTCCATGACAGTTGGCACAGCCGTGCGTT
GCCCCGTGCGGTTGAGGTTTTCTGTCTGTAGCGAGCGCTGCAGCGTCACCATGAGGTCCCCTACGGCCAGAAAGAGGAGGCACGCGATGCCGTAGCGGAT
GAAGCGCCTCCTCGTGCTCGACAGTAGACGCCGCGAGCGCCCCTCCGCCGGCAGCGTCTGACGGGAGCGCAGCCCACGCGTGAGTGGCAGCGTCTCGTTC
AGAGGGTCCGAGCGCAGATACATCTGGAAGGTGTCGAGCTCCTGATGC