Description :
From Genome Similarity Track
Location :
Scaffold_931:1387- 4017
Transcript NameFunction/comments
Phyag_g8757hypothetical protein PHYSODRAFT_347295

Sequence
2630 bases(100 bases per row)
CGCGTGCACCGCAATTCCGTGCCAGGAAGAGGGTACTACCGAAGAGCGAGCCTGCCGTGATGGAGCAGTCTGCGATGGGACCCGTGACCACCACGGGGTG
CAGTGAATGCCGCAGCGTGTAGAAGGCAAAGGCGCCCTGACGGCCCTTGAGCGGCGCGAACGAGTGCGTCGGCGGCAACGCCTCCACCCGCACCGAGATC
TTGCCCGTGATAGCATCGATGTAGGACATCTGgcgcagccgcagcgtctgcgtggGGTCTGCTATcgccttggcgatctgctccttcagtgGCGCGCTCG
CCTTCACAAggtgctccagcagataGTCGTAGCTCCAGGTGCCAACCTCGTCCTGGCTGCCGGCCACCGTGGCGCTCGGCTCCCACGGACTCTCAATGTC
GGCGTCCGCCAGTTCGATGTCATAACCCATTTCGCGAGCGATCATGATCGACTTCTTGGCGCTACGCACGCCCATGACGTCATCTACGATATCACGCACG
CTGAATTCGTTCTTATACTCATCCATGAGATTCTTCATGATGGCGCCTAGGTCCGCCTCAGCCGGCTCAGCGAGGGCGAACACGGCGTCGAACATGGCGT
GCAAGAAGCGGCTGCCCGAGTACTCGACCCGCTGAATGTCGTCGCCCGTCTGGATGAAGTTCTGGATCGTGTTGAAAATGGGCACACCGATGGCTAGTGT
CGCCTCTGGGTCATACGTCAGCTCGTTCTGGatcgccagctcctgcaacgAGTTGTGCTGCTCTGTCGAGGCCGACGACACGTTAATGTTAGACGTCATC
ACGTGCGCCTTGCGGGCCAGCCACTGCGGGTACAGGTCCTTGACGTGGTGAAAGCTGTTGGAAACATCGATGATCAGCCAGTGCGGCAGGTGGTCTGCGC
ACACGTGGTCCAGGAATTTGTTCCGGTCGAACGGCACGAATTCGTCCTTGCGGGCTGCCAACGCCTCCTCGGTGATGTCACCCTcaacgtccagcagcat
ttgcgaGGAAATGTGAGTGCCAATGGCACGAACTCGGATGTCTACGTTGAAACGCTGCTTCAGAAAATCGCGCTGTTGGTGGTATTGCTTCAACAGAGCA
ACGCCAATGCTGTTGgtctcgttctcctcgaactcgagGCCCATGAGGCCGATGGAAAGGGTCTGATCCGACAGGAAGAACGACGAGTGCACGGCAcgta
gtgcagcagcagagtccTTGTAGTGGACCACGGCAGAGATATTGCGCTCGGACGAGCCCTGGGAGATGGCCAGCACGTTAATCTTCGCACGGCCGAGGGC
ACCGAAGAAACGAGCGCACACACCCGGGGTTTGGTTCATCTGGTcacccacagcagcgatgatACTGATCGGCGCAATGTATTCAGCCTTGTCAATGTGT
CCCACGTGGATCTCCTTGAAGAACGTCTCGTTGATCACGTCCTTAGCCACCTCGGCGCAGTCCATGGGCACAGCGAAACAGATTGAGTGTTCCGAACTAG
CTTGCGCGATGAGCACGACGTTCACCTTGACGCGGTCCAGTGCGCTGAATAGCCGCGAGGACGTACCGTGCACACCGACCATGCCGCTGCCTTCAATGTT
AAACAGCGCCAGGTCGTCCACAGTAGAGAATCCGCTCACAATGTTACGCGCTGTGGGGGTGCCATTCGACATGGTACGCTTgagctccaccttcttgcgG
TCCCAAATCTTCGTACCCGGGTGCTCGGGCTCAAACGTATTCCGGATGTAGATAGGGATGCCCTCGACGATGGCAGGGGCCATGGTTTTCGGGTGGATGA
CCTTAGCACCAAAGTACGCAagctccatggcctcctGGTAGGAGATCTCGGGCAGAATCTGCGACTCCGGCACGCGACGCGGGTCGGCGCTCAGCACACC
GCTGACATCTGTCCAAATCGTGACGCTCTTGGCGTGCAGCACGCGGCCACAGATTGAGGCTGTGaagtcgctgccgtcgcgCTTGAGCGTGGTCATGACA
CCCTCcgccgtgctgcagatgaaaCCAGTGACGACCAGGTGCGTGATTTCATCACCCTCTCCGTTCTTCAGAATCTCCTGCATCTTCTGCGTGGACACAT
CATACTGCACCACAGGTCCGTGCTCATTGTCCGCCTCGACCGTCAGGAAATCGCGGGCGTCCACGAATCGGAAGTTGTGCTTCTTGCCGTCCTGTTGCAC
CTTCTCGCTCAGCACGGCCGTGAGGATCTTGGCCGACCAGATCTCGCCGTGGCCCGAGATGAACTCCACCACGTTCTCGTTGTAGGCCTGcatgatggag
atggagcgcaGCAACTCCGAGACGGACTGCAGGtcgcgctcgatctccttctcgatggGCTCGCCCACCTCTGCAGGCAGTAGCGCCCTCACCACATCGT
GGTGCTTCTTGCGGATCGTGGCCAGGATCTCGTTGCACTCGGCGGTGcggcgctgcttggccagctccagcagcgagatgaGCAGGTCCGTGACCTTGGG
CTTGCCGCCGATGgccgacaccaccaccgccacgcgcGAAGCCTCCACAGCCGCCACGATGTCCGCCACCTTGGCGAAGCAGTCGGCGCTGCCCACGGAC
GTGCCGCCGAATTTGTGCACCACGAACTTG