Description :
From Genome Similarity Track
Location :
Scaffold_1644:1387- 3471
Sequence
2084 bases(100 bases per row)
CGTCGTACACGTAGTTGGTCTGGACGCCGTCGTTCTCGTGAAATATGCCAAACACATTCACGTTTACTAGTGAACAGAAGTACCACTGCGAAGGCGTCGA
GGACACCGACGGGACGGTCAAGTTCTGCGAGAAGTCCATCACCAGAACAGCGGTATCATTCTCCCTTCCACCGTTACGAGCTGCAGCCTTGTCAGCTTTG
TACTCCAGTCTAAAAAATATCGAATATATCAAAAAGATATTAGTGTCCGGCGAGAAATCAAAATGTTACCAACATCCATTTGCACTCTTACCGCATTCGA
TGAGCTGATACAGTGTGCTGCCCGAGCTCTTCCGTCTCTTCCGCCGTCGGACCTCCACGCATTCTCGACTGGTAGATAGCACAGAGGTCGCAGACGTTGG
ATCGTGGCGATCGGATCCGAATAGCTGGGCAGTGAAGGCTGAGCAGCTTTCTCATGGTTGCAGGGGCAGGTTCCCGGACCCGTAGCGCTATCTGCTCTAC
GTAAGAGTGCATCTCGTCGTAGATTGCGCTCCACGTGAAATTCGCAGGCAGCAGCGTGTAGTTCTCGCGGCTGTAGTACTTTGTAATCTTGCCGTCGGCA
GTCTTCTGTAGCCGGACACGTACAGGAACCACGTCACCTACTTCTGCGGCAAACTCTTGAAACCACTTCACCAGCCACACGACGTCGACCTTGGCGGCGT
GCTTGTTCAGCTTGTTCCCGTGCGCCTTTGGCGCGATGTTACCACCCCGAACCCTTCCTTTATAGCGCTTAATAGTGAGCGGTGCCACATCAAGGCACTT
TGCAAACGAGGGACGGCATACTTGCCCGATAAAGGGCAAGTAGTAGTGAAACTTTTCTCGCGCCCCGCCACCACGACGCCGCTCAACGGTGTCCGTCTGC
ATCAGCAGTGCCAACATCGTGTAGATACTGGGATACTGGTCATTTGCTCCGAGCGAGTCATCTGGGAGAGTGAGCACACCAACCACTCGATCTCACGCGC
CTTTCCTTCGAGGCAACGGCGCTCGCACGCGTCTGCCTGGATCAACGCAGCAACCTTCTGCTGCAAATCGACCTCAATCAAATTGATACTTATGTCCTCT
TCGTCCTCGCTGGCGCTTTCCACACTCTCGCCGGTCAATCGTTCGTCTTCATCGTCCTCTTCTGCACTCATCGCTTCCTCACTCCAGTCCTCATCCGCGC
TGTTGTCGGGCTCGTCGCTCTCGGCCGCGCTGCTTTCCAGATCGCCTTCGCCGCTGCGACTTTGCTGGACTTGTTCAGTGTCTTGAGCAAGCTGAATGGG
TTAATCAGGCGTCGCAGCGGTTGCAACCGCGCTAGGAGGAAGCGGCATCAACGTCAGGGAGCTCGACGGTGACTGCAGCAGGATGGAGGAGCCTCCTGCA
GTGCTAGAAGGAGTAGGGCTTAGCGGCATGGCAGAGATCTTGACGGTGGTTGGCAAAGTCGATTGCGTGGGCGTCCCAGTTCGGTTTAGTGACGGTTCGA
ATTTTCAAAACACAAAATCCTCCGTTTCTCAAAACTTCATTTAAGTGCGAAAATCAGTCGCCCAACTTTGAAGGCGATTATCTCGATAACTCTAAAAGGT
GGATTAGCAACATTATGTCAGCCGCTGTCTCAAATGACTCCCAGTTCGCTCGGTCTAATACGCTGTTTCAGTTAAAGAATAGATCAGATAAAGAAATGGC
TACACTTCTAATGACTACATTTTCATTTGTTAGGTGCAACTACAAGGGCTTTCTTTACCTGGTACCCCTCCAGCATTTTCGTACTCTTGTTTTGTTTCGT
CTTCACACAGACAGAACTTAACCAATAACGGTAGGCGCGGTATTGTCTGTTCCTACTCCTTCTTCTCATTGGTATTAGCAGAATCGCATCCCCTCAGGTT
GTACGTGAGTTTCAATACAGTGAGGTTATGGGAATATTTGTTGTCCCGATATCCTGCCACCATGCCTGCAGTTTTATCTTTCGCTAGGTATCTACTGCAT
AGCCCCTAGTTGTCTCGACATCATAATATTTTAGTTTTTCGTAAATTCTATATGCACGCTGCGCTGATTGTAATATAACGTGGC