Description :
From Genome Similarity Track
Location :
contig_56:1387- 2533
Transcript NameFunction/comments
g10191.t1hypothetical protein

Sequence
1146 bases(100 bases per row)
ACCCGTTCGAATGCGGCGACTTCGTTTCTTTTTGCCACCAACAGCTCGAGCCAGGGTGACCAGCGATGGCGGAGGATCAGAAGAAACACGATCTCTCAAC
TCTTCCGATTCGCTATCGTCCTCGTCTCCACCCGACGATTCCTCATCTCTTGTATTCTTTTTCGTATTGGAATCATCCGTAGGGTCGTCGTTGTGGCCAT
CCTCATCACCAGAAAATGTATCCATCGCTATGACTTGCGCGATATCACTGCTTGTGGCCATTTCAATGGCATTTTTCGCGACTTCGACTTCACTAGCAGG
GACCAGCACTTCAAGCCCATTAACGTCGATTAGTTCCTCGGAATCACTGTCCTTATCATTTTGGACGCTGAAAGTGAGTGATCGACCCCGGTGCAACCAC
GCACTCTTTTCACTGGCAGTCGCATGCTTCGCGACCTCAAAGAAAATTAGCGCTGGTGCGCGTGCCCGTGTCGTAAAAACAGTCCCTTCTTCTTTTGCAA
TCGTAAGGAGCCGCTGCAGTGGGTCATCGCATGACCCTAGTGGGCAGAAAGCTCCTTCTGGCAACTCGAGTTTTTGCAATTCACGCCTCAATGCGTTCTT
ACGTTCATGCGGAGGACAGAACCTTAGTCTTTCTGTCATCGTACACAGCTCTTCGATGAACTGAATCTGCGTGGTGAAGATCCGACGCTCTTCCCCGTCA
TCACGATGAGAATCTTCTGGAAGAGTATTGCTTGGCAGTAGGAAATCTGGAGGAATTGAACAGCCATTAACAGCATCGCAGATTGCACCAAGCGGAATAG
TGGCCTTCGTATCTGTGTGAACGAGGATTAACAGGCGATCGAACAGACACTTGATGATGGCCGTTTGCTCTGTCGAAGCTGGTAGATCCTTGTCCGTTTC
AAAAGACCAATCTCCATGAGAAATCTGCATCTCTACGTTGATCATTAGCAACTTGCACATGCTCATCTTCCGGTACAGGAACTCGGGCACATACAACTCT
GACTGGCCGAAACCCCATCCACAGCTGTCGTCAATTGCTGCGCGGGTTAACCAGTAGATAGCAGTTGCTAAGCGGATATGGAGCTGAGTCGCGTAGCAAA
TCACTCGAAAAAGAAGTGCCGCTTTGACACTGTTGCTTGTCCAGTC