Description :
From Genome Similarity Track
Location :
scaffold_1897:1387- 2432
Transcript NameFunction/comments
Pl_100254hypothetical protein PHYSODRAFT_434001

Sequence
1045 bases(100 bases per row)
GAGATCAACTCGAAAGACATCTTCATACTCAAGCACAATCTTCCTTAGAGAATCCAAGTATCCATTGTAGAAACCATTGTTACCTGCCGCGACTACCATT
TCCTTCAATTTCTCGTGAATTTCAGAGGGGGGTATAACGTCAGGAATGCCTAAGTCGAGTGGTCTTCGTTTGCAACAGGGGTCCAGCTGCCAGTTGTGAT
AATTGATTATTCACATCGATTCCTAGCGACTTTAAAGTATCATTGTCGAGGATGAAGTCTTCTAGTCCCTTCATCACCTTTCAGTACACTTCCGATATAT
GCACTTGTCCTACGGCTGTCTGCAACAGTAAATCCAACATTACGGCTTCACGACAGTCAACATAGTTTCCCCCAGCAGTACTCTTCTTCTCTACGTGTGG
TAGTGGAACCACGGAAATAGCGGTTCCGACACTAATGAGCCCTTCCAAGTACTGTCGAGTCATGTATGTGGTATAGCAGAACACGCAAAATCATCAGATC
TGGACTCGACACGCAACCACAACAATCGCCGAGTTAGGTCGGCGTTTGTTGGCCTGCGCTGGGTTGTCCCCTAACGGCTCGGCCCTTCCGGGATAGTTAG
CGTGTCACCCCCGCCGTGTACCAACCAAGCCAGCCAATAGTGGTAAATCCCGTGCCCTCCACCAAAGGATGGACGACGGCGTGTTAGCGCTTTTACGGGT
CGCCGAGGCAAAGGCTACTCGGCTAGAAGAGTAACGGTACCCGGGCTGTACGGCATACCGACCTGCCGAGCTTGGCGGGATTTGTCCTTCGCATGTAGCG
AGACACGCCATTCCCCGGGCCGGCTCGTGCAGGGACATAACGGAAGAGTATACACTTGTGTTGGACCTAGAAAATTCTGCTCTGTTATGTTCTAGGGACT
TTATGCTTCAGCGGACTTTTGGCGACCATCCCTGACTTACCTGGTGGTTCTTGGTGTTTTTGAAGTCGAGATGGAAGTTTGAGGAGGTGCGCATGTCTGT
GCACACGTGATAAGTGGTGTAGTGTGTGCGGCTATACTTCACAAA