Description :
From Genome Similarity Track
Location :
contig_5:13868- 22574
Transcript NameFunction/comments
g1604.t1hypothetical protein
g1605.t1hypothetical protein
g1606.t1XP_009517245.1 cyclic AMP-dependent protein kinase-like protein regulatory subunit [Phytophthora sojae

Sequence
8706 bases(100 bases per row)
CCGATAGCTGGAAGTTTGAGTATTTGACCCGACGACAATGCCCTCCGATCCTCGACGTGCTTCGAGAAAGACTCTGATCTTCCATCACAGATCAGCGAGA
CCGGAATCTTCCGATGCAGGCTCAAGGTCTGCATCGCAAAGACATTTAAGCACCAGGCCAGCAAAAGGTCTACGAGTTTTCTGGAGACGCAGACGAACTG
TGACTCCTGCAGGCTTGCGTTCGTTTGTTGTTGCGGAGCATCAATCATCAACTGGGATAAACTCAGCTACACGTCGGTCTAATGATCCCAACGATAATAT
CGTCTTCCTGAACAACCCGACAGAATTTGATCTGCGCTCCTATTTGTTCAAGCGGCGAAGATCAAGCATCGCAACAGATAGACTCGAGAGATCGGTCATC
AGTCAACGCTCTATTGGCAGCAGTCGTCGCAGTCACACGCCCGGGATCACATCGACAGGTTCATTCAAAGGGGAAGCTCTCTTTGAGAAACGAGCAGAGG
TGATGATCTCTTCTGCAGATGCATCGATCGCAAAACAAACGGGAAAACCGCGGCGTAGGCTACGAGCGAAGGAGGAATTATGCATCGTACTTCCTCGATC
CACTGCCCGTGGCCGAACGCGGTCTCAGAAGTCCTGGTTTCTCGGACCAGGATTTATTGGGTGCGACCCAGGAGAAGGCACGCTCGTAGTGACAAAGGAC
AAATCCATGGACGCAGTGCATGCCGAAATCTCTGTAGCAGGGGACGACTACTTCGTACAGGACGCTCAGAGCACAATGGGTACTTTCTTTGCCTGAGTAC
ACGCTACCGACATTATCCACAGAGGGATGGTTTCCGCTTGTGCCATGGAGACGTCTTCCGGATCGGACCGGCTACTTCAATTCGCGTTCTTGATCTGCAA
ACAACCACTGAGACAGCTCCTATCCAAACCACGCGGAGCCGCTCTAGTTCTATCGCCAGCATTACAACCACAGCAGCAGAACAGTCTGCATTAAACTCTG
AGAGCAGTACATCTCATACCCCCAAGCTTGAAAAAACTGCAAGTGCCAGCAGCAACAGCGGTGGAAACGCACAACCAGGTTTGAAACGAATGTCGACCGT
AGAGGAACTTCGACTTCTCGCTGCTGATATTGAAGACGAGCTCATGAACGATGTCGGTAGAATCCATCCAGGAGTTACACCGCAAAATGAAGCCGGCAAC
ATCACCAAAGATGACCACAGAGGGGAAATGCCTGCTCAATTAAAACCGCAGCACATCGTTCACTTTGCAGATACGCCCCCAATGATGTCGGATGGATCCG
TTTTCTTGGGTAGTCGCTACATACGTCCAGAAGTGAAGGAACTGCACTACTGTGAACCATCCCAGGTAGAAGATGCTGAGGATGATACAATCAAGCAACT
CGTTGGAAGTGAGCACGAATCACCACCAACAGAGTACGCTGGCTCAAACATACGCCGGGCTGCATCGATTCGCCTCGTCATTTTCCAACATGATCTGCTA
ATGCCAGTACAGAGCCTTTAAAGCCGCGTGAGGCTCGCGAAGTGACACTGCCTGGCCAAGGAACGTATCTCATCGGCTCCTCAGCTGCTTGCGATGTGCG
CATTTTTCCGTCGGAAGGTATTGAAATCCGTGCTGTGCACGCTCGGATTTTATTTGACGGCACATCGTTCGTGTTGCAGGACGTATCATTTGAGCGCGAT
CCACGTCGACAAACACGCGTTTTACTCACCCAAAGACCCGTGAGAGTTACACGAGGCGATTGGCTACTACTTGGTAAATGTGCGCTGTACATCACGACCG
TGGCCAGAGCCTTTGGCTCGGTGCGCCGTCCAGATATGAAAGAAGCAGCCATGCGCTTGGACGTTTTGAGACTTTCAAAGCGAAAGCCAAGGACACGTGG
TTTATTCGTGCCCGTGGGGTTTCGATTGCACTCGTCATCAGGCTCCGGAGCGTCTAGCGGGAGTAGTGGATGGGTGGCAGCAGTGGCGGGCCTGTCACGT
TTGGCAAAGGGCGAGACTGTGACGCACAGGTTTTCACGGCGTCTCTAGCGACCGAGCAATTCAGCGTCCAGCTTGAGCGGGGAACATGTTTGCTCACGCC
TAAACCAACAGGAATCAACGCTGGCACATACTTCTTGATCGGACGTGATGAACCTGGACAGCCATTCCTCGAAGATGGAGGCTACAACTCGAGCGACACG
GAAGAATCCAAATTCGAGGTGGTCAAACATACGAGCAAGCCTCTACTGCTATCGGAAGGGTGTGTCTTCAGGTGTGGCGGGTGCGAAGTGGAGGTAATCT
ATTCAAAAAGCGCGACTGTATCTGATTTGAAGAGCACTGCTGCTTTTGAAGAGCAAGAGCACATCCGGTTCTTGAGTGGCATGCCATGGTTGAAACCAAT
AGTCTCCGACTTGAAAACCATTGCGAACGTTGCACGCTGCGGCCAGAGATTGAAATTGGGCCCGGGGGAGTTGGTATATGAGAAAGGTGACGCAGCAAAT
TTCGTGTTTATCGTGATCAGCGGCGAGGTGGCGCTCCATATTACCTGTGCGAACGATGAACAGGAAGGGGATGACTCGGAGATATTGACTGAACAAGTGA
CTGCCGGCGGATACTTTGGAGAGGTGAGTTTGTACGACCCGATGGTACTGTACGCTTCCGCACCAAACTGTGATGGTCATGAGTATCCTGAAACTGCGCG
AGCTGCTAGCGCTTGTGAGCTGCTAGCATTGGCTAGAGAAGATGTTTGCGGGTATCTGGGTTTGTATATGGATATTGTACGCGCTCATCTGCGCCACGAT
CAGTGTCGCGACAAGACCATCAGACTGGCATGCATTTGTGTGCCATGGCTGCGGGGGATCTCCCTCCACGAGATGCGCTTTCTTTCATCACAAGCTGAAA
TTGCTGTGTATCCTCCAGGATCGATCCTGTTTGAGGATGGAAAACTTTTTGTCCCCGCTGCTTTTGCTGGCGGAAACACATTTCAACTGCGGGATGGGTT
TCTCGTGCTCATTCGTGGGGATGCCCGGATTGTCAGAAGAAAACATGAGCGACAATATCGGCGAAGCAGAAAAATACACCAGGCAGAGGATGTTGAAGAA
AGAGATTTCGGCGACGTCGACGAGGAACCAGAACAGGATCATGACGAGTGGTGGAGCCCAATGGACCAGTACTTGCATTGAGCTGGAGCTCGTCTCCGTC
TGTGTTGAGCGTTTCTGATCTGTCATTTCGTCTGGAAGCTTGCTCCACCGTTGAGTGTTATTTTGTTGCTGCGGTGCATCTCGCCCATCTGGATGTCGAT
ATCGGAACCAAACAACAGCACACTACCTCTTTTGGGCCAGAGGCGTCTTCTGTCGCCCAGGCTCCACCACCATTGAAACGAGTCCATTCGTTAGGTCCTA
GGCGAATGCACCATTCGCAGGTCGTGACCAGCGCTTTGCACAGTGGTGGAAACAGTCATGGAGACGACGATGACCATAACTCGTTGGACGGGTCCGATGG
AGAAGGTGATAACACCGCAGCTCGCCGATGGAGACGCAAAAAGCGTAACAAGCATCTTCTCGAGCAGACAGTGCTGGAGACGCAAAACGACGCGAAGATA
CCAAACGCGTTGGTATTATACGTGCTGGCGGGGGCTCAGAGAGGGGATATCCACGTGGTTCGCAACGTGGCATCAATAGGCGGCTTTCTTAGCGGAGCAG
ACATCGAACTCAACGACCGGTATATATCCCGTGCACATGCCGTTATTGAATACCATGAAGGCAGATACTGGTTGTACGACAACTGTAGTAAGTGGGGAAC
CTTCGTACGCCTTGAAGAGGAGAACGCCGTCGACATCAATCCAGGAGACGTCTTTTTGGCCGGCGAAGTTGAGTTCACGTGCCTCACGTCGTACCCGGAG
CGAAATAAACCCAGCATGTGCTGTGTAATGTAAGCCATGGCGAACCAGGCCGTGAAAAAGAGTAAATCGTAATGACACTGGATAGAGTACCAGCTTGACC
AGTGGCTTTATTCAACAGTCTTACATGACGCCAGAGATGAAGCAACCAGCACGTGCGCTAGTTCACTCGTTTGAATAAATTCCTGTCCTGATCGGATATC
AACACAGACTGGACCGCTCAAGGCCTGAAGACCACCCACAACAGGCAAAAACTCGATCCAAACAGTCTTCGCTGTCTTGGCTTCTACCATACCAATATTC
TGTGGCATCATGCAGAGCCACACCAAAGAGATCAAAAATGTCAATCACTAGCTACCCTTTTAAAACAGCAGATAGTACTCAAACTTACCTGGTGAGACGC
TGACGAACACACAATACCGTGCATAAGTTCCTTGCGGAACTGTAGTTGTAGTGCGAGGCTTCGAGTAGAGTTGTTGATCACCGATATAGGCACCAGGAAT
GGTTGTCCAACCGCGACTTCCTTGGGTAGTTCCTCAACAATCACTATGACTTCGCTATGCTGCCCTGCTCCAACGCCAGCATGGCCGGAAGCTCCAAGAG
CTTTCCGCATAACTGGCTGACTCTGCACTGATCCTGCTTCTCCCATTGATATTTTCCACCCAACATGTAGTCGGCCAAGGTTTTGCGAGCCCTGGACAAA
TATACACAAAATAACATCTTTTAGATCGAAGAACTTCCCAATTTCGCGCTATGAGGCATTACCTGCGCTGATAACAACGTCGGGTCTGACATGGGGTCGT
ACGATACACGGAACACACGTTGCAGCTCCTCCTGCGGGTATACAAGAGTCTGCGGGCCATTTGTTGCGAGAAGGTCCTGAACTGATAGTTGTTCTCCATC
TGCCTTCTTACCAGCAACGCATCTCTTCCGATGTAAACGGCGGCAAGGGCAGGAATTTGATGCTGTCCACAAAAAGTGGCAGTTTGGACACATTACGGAT
CTGAGCCTCAACGATAGCCTCGCCCTGCTGCTGCTGCTGGTTGTTAGCTGCCGAATTCTGCTTGAACGTGATCACCAATGGGTTCTGCACTGCAAACCGG
TAGAATTTGCGGAGCGACTTGCTTTCGCCGGTCACGGGGTCCACGTAGGTCACGCCCACCCGTAGCACGTGGTTCCCCACCTGATTAAGCGGATAATCCA
CTACCATATCTAGACTGGAACCTGCAGGCAGCACAGCCACAGGATTCGGTGGCGGCAGTTTCCCCGTCCTCGCGTAGCGGTTGTCATGAAGCTCTACCCG
GTCGTTGGCACATTGGATGTTGGCCGACAGCCCGACGTCCCGCAGCTCGCACGAGTACGGGTTGATGACGCTGATGTAGCTGCTGAAGGTGTTGCCCAGA
AAAATCTCTCTGTCATAGTAAAATGCATATAAAACATATTACAAGTAAGACACATCATCCCAAATATGACAATGAAGAAGCTTTTGTCGAACCCGAAGCT
GTCGGGCAGGATGAGCATGCTGGACAGCGCGAACTCGTGCTGTGTGGCGGTGACCTCGTCCAGGGACGCGGGCAGCATGGAACCCCCGGTAACGCCCTGC
GCGTACAGCTTGGGCTTGTACAGTCGCATCACTAACAGACAACAAACAAGAAATCGTATCAAGAGGAATATTTCAGATTAGAGTACAAGAGCCGCAGAAG
AAATAGACTGCCACCTTTGAGCGTGGGCTGCACGGACGGAGAGGACGCTGGCGGGGTGCTCCCGCCGCCGGAAGAGGGCGGGCCGCTGGTCCCGTAAGCG
GAGCTCATGATGAAGGAATAATGGATCGCAAAGTTGCGCTCTCAGAATTATGTTGCTCTATCATTTGCGCACCGTAACGTTGCTATGTTGCGCTGGTATT
GACCCCTCATTTGCTTTCAGAATAGAGGAAGATGCTTGCTCGCTCGCTGTTCCGCGCCGCCTCGAGCGTCCGTGCGTCGCCGTCGCTGGTCGCTTCCTTC
GCCAACGTTGGCGCAATGCAAGTTGCGCGCTTCTCCGACGCCCCCACGGTGCGATTTGTCTCGAAATGTGCGTCGAATTACGTGAAAACTCTCGTCTCAA
AGGTTGTTCATGATGACTGCGTAACGTTCAGATGCACGGCACGACGATCTTGTGCGTCCGCAAGGGAGGCAAAGTGGTGCGTTGGATAGAGCGGAGAAAA
GTGCATCGCGTATGTTAACTTGGCGAAGAAGGAGGGCTAATTGTTGCTGTAGTGCCTGATCGGAGACGGCCAGGTGTCGCTGGGCAGCACGGTGGTCAAG
CCCAACGCCAAGAAGGTGCGTCGCATCGGCGAGCACATTGTGGCAGGCTTTGCTGGCTCCACGGCGGATGCGTTCACGCTCATGGAGCGTCTGGAGGCCA
AGCTGGACGAATACCCGGGACAGCTCACGCGGTCGTGCGTGGAACTGGCCAAGGCTTGGCGGACGGACAAGTACCTGCGTCGTCTGGAGGCCATACTCAT
CGTCTCGGACACCAATCAGTCGTACACGCTGACGGGCAACGGAGACGTGCTGGAGCCGCACGACGGCATCATAGGCATTGGCTCGGGAGGCACCTACGCT
CTCGGTACGTGCAGCCTGGTGTTTAGTGAGCTTTTTATTGTTATTTTTGTGGAGATGATTGACAGCGCTGTGTTGGACGTTGTAGCCGCTGCCCGTGCGC
TTATCGACCAGGACCTGGACGCCGAGACCATCGCTCGCAAGTCCATGAAGATTGCCGCCGACATTTGCGTCTACACGAACGAGAATGTTACTGTGGAGAT
GCTGGGGGAGGGGGAGTCTGAGGCCAAGACTGACAACAAAGAGTAAGATGAGGTAGAACAGGTTGCACTGAGGCGTGTAATTCGTCAGCAACGCTCGAGT
AAATACAAGGTCTGAGCTGTTGAGTTGAATCGCCTAACCATTGCAAGCAGAACGTAACCAAGGCACAATGGCGTGTCTGAAAAATATGAATATGATAGTC
GTGGTCGGGCAAAGGAAGACAAAGAGAACGCTAACAAACGTCACCGAAATGACTGCCATCGCCGTCTGCCCCGTGAATGCAACGCCAGCATCTCGGTTGT
CAGTCACAGTCCACAGTAGTGTGGCACGCGAGGTGCCAGATGTCCTTCGTCCCTCGTCCCTCGGAAATTGTGATGGTTGAAGGCGTGTATAAGATGTAGT
ATTGGTGCGCGTGTGCGTTTTCCTTTTCCTGATGCTGCTTAAATGTTGTTGGCGATGACCGAGTTGTACTTGTCGATGTTGCGCTTCAGAATGTCTTCTA
GCGGGCCCATAACTCTCTTGAACGTTTTACGGTCCAACGTGAGACACTTAACCTTGCCCTGGGCGGTCACTGTTGCCTGACGAGGCCGAGTTGTGAGCAG
TGCGATTTCACCAAAGTACGCGCCGGATGTGAGCTGGCCCATTTCCACTGGCGGGTCTGCGGGCGAGAGCTGCTTCGTGCACACTGCCGAGCCTTCCTCA
ATAATGTAAAACAGGTTGCCGTCGTCACCCTGTGCGATGATGACTTCGCCATCACTAAACGTTTCTGTCTTCAGAGCGTCTGCGACTGTGAGACGCTCGT
ACTCGCTGAGCGACTCGAGCAGTGGTACACGCTCAATGAAGCCCTTGTGGGCCTCGCGTTTCTTCAATGTCGTTTCCATGATGATAAACTTGAAAGTCTG
GCGATCTAATGCCCACGCCTTCGAGTGCTGCACTGCTTTAACGGTTGCTGCTCGCGGAGCATTGTACATGAGGGCCAACTCGCCGAACGACATTGCTTCA
GTGCACTGCATCAGAAGACAAAAAACATGAGCACCCTGCCACTGAAAAAAAGCAAGAACCCCTTCAGTAGTGAACCCACCGTCTGTACGAGATCGCCGTC
CTTGTAAACTTCACATACGCCGCTCTCCAGAATGTAAAAGTTATCTCCGTCGTCACCCTGCTTGATGATGGTGTCACCAGGCTCGAATTCCTTGGGGAAC
ATGGCGTCGAGCACAATTTCGTGCTGCTTCTCGTCCAGCGACTTGAACAAAATGTTCTCCACGACCATGCGACTGATGCCCTCCCGCTCCTCTGTAGACT
TGGGGTGCACCACGCGCTCAAACTGCCGCGCACTGCCACGTCACACCAAGTCAGTTTACCATCAGACAGGACAGCGCCACCTCATAACAAACTGCTCACC
TCAGCGGGTCAATGGTTTCAGCGGACACCGAAGTGCGCCGTCCCTTGGCCATGATCTTGGGCGGCGGCGCGCTGGCTGCGATCTCGCCCACGGCGTCTCC
ACCCTCATCCTCGTCCTCGCTCTCGGACTCGTCCGAATGATCTGCCAAGAAAATGCACATTAGATCTCCATTCTCTACCATTAGGTAGTGTAACTGCCCA
CGACGCACACTGCACGTGGGGCGAGGCGGCTGGGTTGTCCTCCTTGGCCCCAGGCTTGCGGCGAGGTGTGGCCTCCTCCGGGTAGTTGGTCTGCAGGTAC
TGGATGATGTGCAGGATGGGGTTCTCGGGCTTGGCCAGCAGCAGCGACTCGACGAGGTTGATGAAGAGCGTGTTGATGCCCTTCTTGTGCAGGTAGTCCT
GCAGCTCCTGTTGGACGCCCTCTGCGTCCGTCATGCTCCTGTGCGGCGAGTGTCCGTCTTGCGAGTGGCTAGCTGGATCCTTCCGTCTCGGGCTTCTGCG
TGGGCCTGAAAACTAAACTGAGCCTGGCGTCACGGGGCCTTCGCTCCAAAATGGAAGAAACCCCTGCAACAGACGCTGAACCCAAGCGAAAGATCGCCCC
TTGTCG