Description :
From Genome Similarity Track
Location :
Scaffold_483:13865- 15485
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_483-abinit-gene-0.29Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_483-fgenesh-gene-0.7TRNA-methyltransferase subunit WDR4

Sequence
1620 bases(100 bases per row)
GGCGGCTTACCAGCCACATGAATGAACTAAAGTCGTACATGCGGTGTCACCAGCGCCTGCTGCGTCGTCTCGAGCAGATGCAAAAGCAAGGCCGAAGCGA
CCAAAAAGGCAGCGAAGACGACGTGATCCCAGCGTACGTCGTGCAACTGTTTGCCAAGCCGAAGAATCACATGGAAGCACATTTGCGAGTCTTAGCTCAA
AGGTACTCGCTTGAATTTTGCCGATGTGTGTGTGTTATCTTGCCAATTCATGCACCTCGTGACAATGACTATTGATATTTGTGTGTGTGTGGCTCAGTGT
GAAAATGGTCGAAGACGAGCAACTCTTTTACAAATGGATCAACAGTCTGCTGGCGACGTATCCCTTCCAGGGCAATGATAGCAAAGCCAACGATGCATCG
CTCGCCAAGTCGTTTCCAGCATTTTTCCAGGAAATCCAAGCCACGCAAGCGCTTTTCCAGACCAATTTCGCAGCGTATCAGGAACTCAGCAGGCGCTTTG
AGCTGGAGTGGAAGAAATGGAGGCAGGAGAAACAGAAATCGCGTTCCCAACTGCAGCAAATGGAGATGAAAATGGAGCGCATCAGTCAAGATGTGGCATC
CCGAGAGCTTTTCGACCCGCAAAAGCTGTTCCTGCAATCCGCGCAGTCGTGGGAAACGCAGCGATGCAAGATCAGCGATACACTTGGGATACAAACAAAG
CAACAACAAGTTGCTTTCCCATGTGAACAGGACTTGGAGAGTCTCAAGTCGCAATTGGATCGAGTGCTCAAAGAGATCTCGACCGAGTACTGCCACGCAC
AATTTCGATGAGAACAAGATTGTTGAAATAGTATGCGTGTCGTGGGAAGCCGACGTCTATTCGATTGGGGGTCTGTTTCTTTAATTAATTACTGGAGCAC
CTTGGCTTTCCACTCGGTCTTGACTTTCTTCTTCTTCAGACCATGCTCTTCGAGTTCGTCGACCTCTTCGTCGCCTACGGCAGCGAGTTCTACGCAAAAA
GACACACACACACACACATATGTAAAACAGAGTTAGCAACAAAGTTGATGAATAAGCAAATCCAACAAGATGCGAGAGTCTCGTACCAATGGTAGCAAAC
TTTGCGCGCACTTGCGCCAATGCTGCCTCGTCCACAAGCGACCCAGGCGCAATCTCAACAGACTCCCCATCCGTCTTCGTGACACTGTAGAAGCTGACGA
ATGGCGCATTCTTGTGGGATACGACCAACGCGCCGCTGCTCGTGAAGCAGGCTTCGCACGGTTCGTTCGCGTTCAGCTGCTTTTGCAGATCCGCAGAGAC
GTCTACGTTCTCGAGCGCTGGCGACTGTCCTTCGCGCGCCACGATCGCAAACAGACGCACGCACTGGTTGTTCAACACAACGGCGACGAGGTTCGACTGC
GCCGAGACTGCGAGCGACGCGTTGAGTAAGTTCTTCGAGTNNNNNNNNNNNNNNNNNNNNNNNGTCCTTGAGCAGCTCCTGGGACGCAAGGAGTTCGCCT
GATGCGATCCCCCAGAGCTTGATCGTGTTATCCAACGACGTTGAGACAGCGAGTTCTGGCGTCAACGAGCTCGCAGCGACTTCTGTGAGACTCGCAGCGT
GGCCCAAGCAGTAGCTCTGG