Description :
From Genome Similarity Track
Location :
Scaffold_76:138645- 139986
Transcript NameFunction/comments
Aphas_H257_15359Hypothetical protein
Aphas_H257_15360Transmembrane emp24 domain-containing protein 2

Sequence
1341 bases(100 bases per row)
GATGGAGCGTCGGCAGTGCATGCGGTGGCCGTGCGCAAGAAGAGGAAAATCACACCCATTTTGGTCGGGGAGCCTTCCGTCGCTCCTGTCCATGCACCCA
CAGCCGTCGTGCTTCATGAAGAGCCGAAGGATCCAGCGGCGGCGACGGCGGTACATGCGACGATCGACCTGACGTTAGACGAACGAGATGATGTACAGGG
AGTGGTGGATAATGAGTCGTCTGTTAATGACATGTAGTTTACGGCAGTTCAAACGCTTTGATGGTCTTGAACACGATAAAGTACCCGTACGCAGTGCCCA
GGCCCGCCAAGACGATGATATTGATCCAGTTGAGCACCGAATGGCTCTCGGGGGAGGACACCTGCGCACGGACGAGCGCGAGCGCTTGGAGGGTGAAGCA
GAGGCAGTACGCTTGGCAGAATGTCTTGCGGACCAGTCCATCACCCACGAGACGTGTCTTCCACACGAGCCACCCTTGCGCCAATGTCAGCGCACCGTAC
AACCGCACGACTTCGTGCACCAGGTGGCCGTACTCGGACCCGCCGAGCACCGATACTGCGAGGGAATGCGGCAGAAGGAAGCACGCGCCACCGATGATGA
TGGCAATGCATGCATGTACGATGAACAGAGTGTCCAGGCGTCGTCGCGCTTCGTTCATAGAGCCTGCATGTGACAGCAGCACCTGATCCCACCATGATGG
AGCTCTCCCTGACATCTTCACAAAAATATAATACTGCGTAATGGGATTTAAACTCTAATTTTAAATTCACTCTTGTGATACAATGGGATACTCCGGAGTA
CCAGGTATTTATATAATTATTTTCACGGCTGCATTTTGCGGTTCCTAGCAGTGCTCCGACATGTCGATCCGCGCCGCCATCTTGCTTGGTATCCTCGTGT
TCGTGATGGGCCTGAACACGGACATTCCATCTGGGCATCCCGAATGCTTCTTCCTTGAGTCCCAAAAGTACAAGGAAGGCATGTCGCTCAACTACGAAGT
GCTGCGGGGCATGGGCGACGAACTGGTGACCACATTGAGCAGTCCCAGCGGCATCACGCTCTTCCAAAAGACAGGTCCGTCCGGCCGCTTCGTGAGTCCT
GTGCCCGAAGACGGAATGTACCGCGTGTGCTTTGCCCAGTCCACCCTCGTGAACATCCGCGTGGGGTTTTCGTTCCACGCGGACGACCCGGCGCACGATG
TCGTGTCGAATGCCGACGCGACCAAGATTGAGCAAGCCCGCGCGGTCGAGGACATGGTGTACGAGCTCAACACGAACTTGGACACAGTCAAGGACACCCA
GTCGTACATGAAGGCCAAGTCCGTCTACCACCACAGCGGTA